Fig 1: Generation of Camk2a and Camk2b Mutant Mice and Their Sleep Phenotypes.A A schematic diagram illustrating the strategy using a pair of sgRNAs to mediate the deletion of exons 5 and 6 in Camk2a with sgRNAs CTGGATCACGAAGACCCCTG and ACCTGAAGGTGAGTAACCCT. B A schematic diagram for the deletion of exons 7 and 8 in Camk2b with sgRNAs TTGCAGTCACCTATGTCACG and TGTGTGAGGGGAAACACCTG. C Western blot analysis of CaMKIIα and CaMKIIβ from the brain lysates of mice with the genotypes of Camk2a−/−, Camk2a+/− and Camk2a+/+ (4 mice for each genotype shown here). Grayscale values of each genotype were analyzed. D Western blot analysis of CaMKIIα and CaMKIIβ from the brain lysates of mice with the genotypes of Camk2b−/−, Camk2b+/− and Camk2b+/+ (4 mice for each genotype shown here). Grayscale values of each genotype were analyzed. E–J Analysis of sleep in Camk2a+/+ (n = 7, black curve and bar), Camk2a+/− (n = 10, blue curve and bar) and Camk2a−/− (n = 9, red curve and bar) mice. Profiles showing wake time of each hour in min/hr. E profiles of NREM sleep (F), or profiles of REM sleep (G). The x axis shows zeitgeber time (ZT) with the white box indicating light phase (or daytime) and black box dark phase (or nighttime). Twenty four hours, daytime and nighttime durations of wake (H), NREM sleep (I) or REM sleep (J) shown in mins. K–P Sleep of Camk2b+/+ (n = 11, black curve and bar), Camk2b+/− (n = 12, blue curve and bar) and Camk2b−/− (n = 16, red curve and bar) mice. Profiles of wake time (K), NREM sleep (L) or REM sleep (M). Twenty four hours, daytime and nighttime durations of wake (N), NREM sleep (O) and REM sleep (P). ns, not significant; *p < 0.05; **p < 0.01; ***p < 0.001 and ****p < 0.0001; mean ± standard error of the mean (mean ± SEM). Two-way ANOVA (E, F, G, K, L, M); One-way ANOVA (C, D, H, I, J, N, O, P).
Fig 2: CaMKIIα T286A and K42R mutated forms rescue NMDAR, but not AMPAR, EPSCs or sLTP. a Timeline of the experiment. b Scheme of the structural organization of CaMKIIα showing point mutations (K42R dark green and T286A light green). c, d Scatterplots showing amplitudes of AMPAR EPSCs for single pairs (open circles) of control and transfected cells of DKO + CaMKIIα T286A (c, n = 18 pairs), and DKO + CaMKIIα K42R (d, n = 23 pairs). Filled circle indicate mean ± SEM. (c, Control = 110.9 ± 17.8; DKO + CaMKIIα T286A = 49.7 ± 9.1 p < 0.0001; d, Control = 148.4 ± 20.4; DKO + CaMKIIα K42R = 53.5 ± 7.5 p < 0.0001). e Bar graph of ratios normalized to control (%) summarizing the mean ± SEM of AMPAR EPSCs of values represented in c (43.9 ± 6, p = 0.0009) and d (45.4 ± 5.1, p < 0.0001). DKO data (red bar) from Fig. 1l are included in the graph. f, g Scatterplots showing amplitudes of NMDAR EPSCs for single pairs (open circles) of control and transfected cells of DKO + CaMKIIα K42R (f, n = 23 pairs), and DKO + CaMKIIα T286A (g, n = 21 pairs). Filled circles indicate mean ± SEM. (f, Control = 76.1 ± 6.6; DKO + CaMKIIα K42R = 75.3 ± 8, p = 0.93; g, Control = 38.6 ± 3.8; DKO + CaMKIIα T286A = 32.6 ± 3, p = 0.078). h Bar graph of ratios normalized to control (%) summarizing the mean ± SEM of NMDAR EPSCs of values represented in f (107 ± 13, p = 0.84) and g (86.8 ± 6.9, p = 0.70). DKO data (red bar) from Fig. 1p are included in the graph. i Fluorescence GFP image samples of spine structural plasticity during sLTP. The red dot indicates the spot of glutamate uncaging. Scale bar 1 μm. j Long-term spine volume change of WT (black), CaMKII DKO (red) and DKO + CaMKIIα T286A (green). Each point represents the mean ± SEM % of volume change every 30 s. k Bar graph of averaged volume change at 20 min. Values represent mean ± SEM as % of baseline volume (Control = 145.5 ± 6; DKO = 100 ± 7.1; DKO + CaMKIIα T286A = 100.1 ± 2.3). Number of samples (spines/neurons) is 14/8 for control cells; 10/6 for DKO, and 8/6 for T286A replacement. Raw amplitude data from dual cell recordings were analyzed using Wilcoxon signed rank test (p values indicated above). Normalized data (including sLTP) were analyzed using a one-way ANOVA followed by the Mann−Whitney test (***p < 0.0001; **p < 0.001). Scale bars: 50 ms, 50 pA. See also Supplementary Fig. 4−6
Fig 3: The Cdc42 downregulation suppresses sLTP induced by single- and clustered-spine stimulation.a Verification of shRNA. HeLa cells were transfected with control shRNA (shCtrl) or shRNA against Cdc42 (shCdc42), coexpressed with wild-type Clover-Cdc42 or its shRNA-resistant mutant (Clover-Cdc42res), respectively. The transfection of shCdc42 suppresses the expression of Clover-Cdc42 (lane 2 in the top panel). The transfection of shCdc42 does not suppress the expression of Clover-Cdc42res (lane 3 in the top panel). Averaged time courses of spine volume change upon single-spine stimulation (b) or clustered-spine stimulation (e) in neurons under manipulations of Cdc42 signaling. For single-spine stimulation, n(spines/neurons) = 17/6 shCtrl, 13/7 shCdc42, and 12/4 rescue. For clustered-spine stimulation, n(spines/neurons) = 51/6 shCtrl, 45/7 shCdc42, and 25/4 rescue. Quantification of transient (c, averaged over 4–6 min) and sustained (d, averaged over 20–30 min) spine volume change after single-spine stimulation. The data set used in b was analyzed. n(spines/neurons) is the same as in b. f Quantification of spine volume change (averaged over 20–30 min) after clustered-spine stimulation. The data set used in e was analyzed. n(spines/neurons) is the same as in e. g A model of CaMKII-dependent Cdc42 activation and its relationship with sLTP. Simultaneous activation of CaMKII in clustered spines leads to enhanced Cdc42 activity and sLTP. For all figures, the data are presented as mean ± SEM. Statistical comparisons were performed using two-tailed unpaired t test (c, d, and f). ***p < 0.001; **p < 0.01; *p < 0.05; N.S. not significant. Source data are provided as a Source Data file.
Fig 4: Temporal requirement of CAMK2B in locomotion.(a) Schematic overview of the generation of the floxed Camk2b and Camk2bΔEx2/ΔEx2 mice. Camk2b locus and targeting construct with Exons 1, 2 and 3 depicted in black boxes. LoxP sites are indicated by the black triangles and the Frt sites are indicated by the grey ovals. The Diphtheria Toxin Cassette (DTA) was inserted for positive selection. Recombined depicts the mutant Camk2b locus after homologous recombination. Floxed depicts the Camk2bf/f mutant locus after transient expression of the Flp recombinase, resulting in a floxed locus without the neomycin cassette. Δex2 depicts the Camk2bΔEx2 mutant locus after Cre-mediated deletion. (b) Immunohistochemistry stainings of CAMK2B, showing (Top to bottom, left to right): normal expression in WT mice and no expression in Camk2bΔex2/Δex2 mice; normal expression in Camk2bf/fmice and deletion throughout the brain in Camk2bf/f;CAG-CreERmice (a). (c) Western blots using an antibody specific for CAMK2A and CAMK2B in Camk2bΔex2/Δex2and Camk2bf/f;CAG-CreERmice and their control littermates. Actin levels are shown as loading control. Decreased levels of CAMK2B in Camk2bwt/Δex2 mice and no detection of CAMK2B in Camk2bΔex2/Δex2and Camk2bf/f;CAG-CreER mice in hippocampus, cortex and cerebellum with no changes in levels of CAMK2A. (d) Camk2bΔex2/Δex2 mice (n = 8) show a significant impairment in locomotion compared to wildtype littermates (n = 8). (e) 8–10 week old Camk2bf/f;CAG-CreERmice (n = 13) and their Camk2bf/f control littermates (n = 17) were trained on the rotarod before (Day 1) and 4 weeks after Tamoxifen injections (Day 28). Before deletion, both genotypes performed equally. After deletion, Camk2bf/f;CAG-CreERmice showed a significant impairment of locomotion compared to Camk2bf/f control littermates as shown in the 5 trials given 28 days after the first injection. (f) 8–10 week old Camk2bf/f;CAG-CreERmice (n = 8) show no impairment in locomotion compared to Camk2bf/f control littermates (n = 8) 4 weeks after Tamoxifen injections with no prior training. Error bars indicate SEM.
Fig 5: CoCl2 incubation induces changes in NCC expression, CAMKII-β expression, and phosphorylation in mDCT15 cells. (a) NCC expression significantly increased after 1 h of CoCl2 treatment, showing a time-dependent effect. (b) p-NCC expression significantly increased after 1 h of CoCl2 treatment; (c) CAMKII-β expression increased significantly after 1 h of CoCl2 treatment; (d) p-CAMKII expression significantly increased after 1 h of CoCl2 treatment. (e) Representative Western blot images showing NCC, p-NCC, CAMKII-β, and p-CAMKII expression in mDCT15 cells following CoCl2 treatment. All protein levels were normalized to Na+/K+-ATPase (for NCC and p-NCC) and β-actin (for CAMKII-β and p-CAMKII). Cells were treated with 300 µM CoCl2 for 30 min, 1 h, 6 h, and 24 h. Data are presented as the mean ± SD. Error bars represent the standard deviation (n = 3–5 biological replicates, t = 6–10 technical replicates). Western blot band was calculated for its density by Image J software. Statistical analysis was performed using repeated measures ANOVA, followed by Dunnett’s post-hoc test for comparisons with the control group. * p < 0.05, ** p < 0.01, compared to the control, N.S, not significant. Pairwise comparisons between treatment groups were also performed using Tukey’s post-hoc test. Different letters indicate significant differences between groups (p < 0.05).
Supplier Page from Abcam for Anti-CaMKII beta antibody