ERF Antibody PA5-30237 from Thermo Fisher Scientific

Product Specs
ItemERF Antibody
CompanyThermo Fisher Scientific
Price Supplier Page
Catalog NumberPA5-30237
Quantity100 µL
ApplicationsImmunocytochemistry, Immunohistochemistry (Paraffin), Western Blot
Conjugate/TagUnconjugated
FormatPBS with 1% BSA, 20% glycerol and 0.025% Proclin 300; pH 7
ReactivityHuman, Mouse
ClonalityPolyclonal
TargetERF
IsotypeIgG
HostRabbit
NCBI Full Gene NameETS2 repressor factor, Ets2 repressor factor
NCBI Gene AliasesCHYTS, PE-2, PE2, CRS4
Concentration0.24 mg/mL
ImmunogenRecombinant protein encompassing a sequence within the center region of human ERF. The exact sequence is proprietary
Storage Temperature-20° C, Avoid Freeze/Thaw Cycles
PurityAntigen affinity chromatography
Antibody TypePrimary
StorageStore at 4°C short term. For long term storage, store at -20°C, avoiding freeze/thaw cycles

Add to Compare List

Thermo Fisher Scientific

81 Wyman Street

Waltham, MA 02451

United States

Phone: 800-678-5599
Fax: 800-331-2286

Company Profile

Website: www.thermofisher.com

(1) Regulatory Network Inference of Induced Senescent Midbrain Cell Types Reveals Cell Type-Specific Senescence-Associated Transcriptional RegulatorsbioRxivFebruary 6, 2025Taylor Russo, Jonathan Plessis-Belair, Roger Sher, Markus Riessland4°C. The following primary antibodies were used: rabbit polyclonal ERF (Thermo Scientific, Catalog No. PA5-30237, 1:1,000), rabbit polyclonal SOX12 (Thermo Scientific, Catalog No. 23939-1-AP, 1:1,000), rabbit polyclonal

(2) The CIC-ERF co-deletion underlies fusion-independent activation of ETS family member, ETV1, to drive prostate cancer progressioneLifeNovember 16, 2022Gupta N, Song H, Wu W, Ponce RK, Lin YK, Kim JW, Small EJ, Feng FY, Huang FW, Okimoto RA.for IP were as follows: CIC (Thermo Fisher Scientific – PA146018) and ERF (Thermo Fisher Scientific –PA530237). Paired-end 150 bp (PE150) sequencing on an Illumina HiSeq platform was then performed. ChIP-Seq peak

(3) ERF mutations reveal a balance of ETS factors controlling prostate oncogenesisNatureJune 29, 2017Bose R, Karthaus WR, Armenia J, Abida W, Iaquinta PJ, Zhang Z, Wongvipat J, Wasmuth EV, Shah N, Sullivan PS, et al.immunoglobulin-G ChIP were described previously15. ERF ChIP was performed with anti-ERF antibody (Pierce PA5-30237). For ChIP–qPCR, the ETS2 promoter primers (forward: TTACTTCCTCCAGAGACTGACGA; reverse: CGCCGGCCAGAGACGAT)

Be the First to Write a Review!

ERF Antibody

ICC/IF

ERF Antibody

ERF Antibody from Thermo Fisher Scientific

Thermo Fisher Scientific

Citations (3)

Reviews

ERF Antibody from Thermo Fisher Scientific

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map