Ac-MMP-9 (4A3) Antibody sc-21736 from Santa Cruz Biotechnology, Inc.

Product Specs
ItemAc-MMP-9 (4A3) Antibody
CompanySanta Cruz Biotechnology, Inc.
Price $316.00Supplier Page View Company Product Page
Catalog Numbersc-21736
Antibody TypePrimary Antibodies
NCBI Gene AliasesMMP-9, GELB, CLG4B, MANDP2
Clone4A3
Quantity200 µg/ml
Reactivityhuman
ApplicationsWB, IF, IHC(P)
FormatPurified
Conjugate/TagUnconjugated
ClonalityMonoclonal
Hostmouse
NCBI Full Gene Namematrix metallopeptidase 9
TargetAc-MMP-9
IsotypeIgG1

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Sporoderm-Removed Ganoderma lucidum Spore Powder May Suppress the Proliferation, Migration, and Invasion of Esophageal Squamous Cell Carcinoma Cells Through PI3K/AKT/mTOR and Erk PathwayIntegrative cancer therapiesJanuary 1, 2021Liu G, Zeng T.

(2) Leptin Upregulates the Expression of β3-Integrin, MMP9, HB-EGF, and IL-1β in Primary Porcine Endometrium Epithelial Cells In VitroInternational journal of environmental research and public healthSeptember 7, 2020Wang H, Fu J, Wang A.

(3) Upregulated microRNA‑330‑3p promotes calcification in the bicuspid aortic valve via targeting CREBBPMolecular medicine reportsSeptember 1, 2020Zheng R, Liu H, Gu J, Ni B, Sun H, Guo Y, Su C, He K, Du J, Shao Y.Inc.",Monoclonal GAPDH,ab8245,Abcam,Monoclonal CREBBP,ab2832,Abcam,Polyclonal MMP2,sc-13594,"Santa Cruz Biotechnology, Inc.",Monoclonal MMP9,sc-21736,"Santa Cruz Biotechnology, Inc.",Monoclonal Antibody information. BMP2, bone morphogenetic protein

(4) miR-5089-5p suppresses castration-resistant prostate cancer resistance to enzalutamide and metastasis via miR-5089-5p/SPINK1/ MAPK/MMP9 signalingAgingJuly 21, 2020Wang ZC, Li Y, Wang KL, Wang L, You BS, Zhao DF, Liu ZQ, Fang RZ, Wang JQ, Zhang W, et al.incubation with primary antibodies against SPINK1 (1:50, Santa Cruz, sc-374409), MMP9 (1:50, Santa Cruz, sc-21736) and ki67 (1:100, Wanleibio, WL01384a, Shen Yang, China) at 4°C. A rabbit two-step assay kit (PV-6001,

(5) The curcumin analogue WZ35 affects glycolysis inhibition of gastric cancer cells through ROS-YAP-JNK pathwayFood and chemical toxicology : an international journal published for the British Industrial Biological Research AssociationMarch 1, 2020Chen T, Zhao L, Chen S, Zheng B, Chen H, Zeng T, Sun H, Zhong S, Wu W, Lin X, et al.

(6) Curcumin derivative WZ35 inhibits tumor cell growth via ROS-YAP-JNK signaling pathway in breast cancerJournal of experimental & clinical cancer research : CRNovember 8, 2019Wang L, Wang C, Tao Z, Zhao L, Zhu Z, Wu W, He Y, Chen H, Zheng B, Huang X, et al.(#9272) and GAPDH (#5174) were obtained from Cell Signaling Technology (USA). MMP-2 (sc13594) and MMP-9 (sc21736) were purchased from Santa Cruz Biotechnology, Inc. P21 (10355–1-AP) were obtained from Precision Technologies

(7) Deoxypodophyllotoxin inhibits cell viability and invasion by blocking the PI3K/Akt signaling pathway in human glioblastoma cellsOncology reportsApril 1, 2019Wang W, Gao W, Zhang L, Zhang D, Zhao Z, Bao Y.(MMP)2 AGGAGAACACGGGATGAGGA AAGGCCGAAGCAGCAAGTAT ATTTGCAGCCCAGGAGGATT TCAGCACAAACAGGTTGCAG TTGTATCCGGCAAACTGGCT TTTGCCGCATCTGCGTTGCTGT GGCAGGCATGTTGACTTCAC GTCCAATGTCCAGCCCATGA ATGCCAGGGTACATGGTGGT (cat. no. sc‑13594), MMP9 (cat. no. sc‑21736) and GAPDH (cat. no. sc‑47724) all from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA) at 4˚C. The

(8) The curcumin derivative WZ35 activates ROS-dependent JNK to suppress hepatocellular carcinoma metastasisFood & functionMay 23, 2018Wang L, Han L, Tao Z, Zhu Z, Han L, Yang Z, Wang H, Dai D, Wu L, Yuan Z, et al.

(9) Silencing LDHA inhibits proliferation, induces apoptosis and increases chemosensitivity to temozolomide in glioma cellsOncology lettersApril 1, 2018Di H, Zhang X, Guo Y, Shi Y, Fang C, Yuan Y, Wang J, Shang C, Guo W, Li C.Cell Signalling Technology, Inc. (Danvers, MA, USA). Antibodies against MMP‑2 (sc‑53630, 1:500), MMP‑9 (sc‑21736, 1:500) and VEGF (sc‑365578, 1:500) were from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). siRNA

(10) High glucose induces podocyte epithelial‑to‑mesenchymal transition by demethylation‑mediated enhancement of MMP9 expressionMolecular medicine reportsApril 1, 2018Ling L, Chen L, Zhang C, Gui S, Zhao H, Li Z.Biotechnology. The membranes were incubated overnight with primary antibodies directed against MMP9 (1:500, sc-21736), α-smooth muscle actin (α-SMA, 1:500, sc-71625), podocalyxin (1:500, sc-23904), fibronectin-1 (1:500,

(11) TPX2 promotes cell proliferation and migration via PLK1 in OCCancer biomarkers : section A of Disease markersJanuary 1, 2018Ma S, Rong X, Gao F, Yang Y, Wei L.

Be the First to Write a Review!

Ac-MMP-9 (4A3) Antibody

Ac-MMP-9 (4A3) Antibody from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (11)

Reviews

Ac-MMP-9 (4A3) Antibody from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map