Fig 2: Association of RCORs with HCC. (A) Correlation between RCORs and immune infiltration from GSCA database; Expression of immune checkpoint moleculars between differentially expressed groups of RCOR1 (B), RCOR2 (C) and RCOR3 (D) in HCC; (E) Survival analysis between high and low HCC stemness groups; (F) Multivariate cox regression analysis; (G) Stemness indices among different molecular subtypes; (H) Relationship in tumor stage, subtype and stemness status. *p < 0.05, **p < 0.01, and ***p < 0.001.

Fig 3: TNF-α stimulation induces Nurr1 phosphorylation by NIK, which triggers its association with CoREST repressor complex for HIV silencing.A, schematic presentation of TNF-α induced Nurr1 phosphorylation and its association with CoREST for HIV silencing. B Knock down (KD) of NIK in HC69 cells with NIK specific shRNAs (Santa Cruz Biotech, Cat# sc-36079V) and control shRNA respectively. Left: The relative levels of NIK mRNA from HC69 cells expressing control shRNA (grey bars) and NIK shRNA (green bars) was measured by qRT-PCR using the primers 5’ TGCGGAAAGTGGGAGATCCTGAAT 3’ (forward) and 5’ TGTACTGTTTGGACCCAGCGATGA 3’ (reverse). Expression levels were then normalized to the β-actin gene. Right: Western blot analysis of NIK protein levels using a rabbit monoclonal antibody (abcam Cat # ab203568). C. Co-immunoprecipitation (co-IP) of CoREST, pSer-Nurr1 and Nurr1. Total protein extracts from HC69 cells expressing control shRNA or NIK shRNAs that were untreated, induced with a high dose (400 pg/ml) of TNF-α for different time points, or stimulated for 24 hr followed by a 24 hr chase. co-IP experiments were performed using a mouse monoclonal anti-Nurr1 antibody (Santa Cruz Biotech) or control mouse IgG. Right: The co-IP products were analyzed by Western blot to detect the pulled down Nurr1 protein (using the same anti-Nurr1 antibody), serine-phosphorylated Nurr1 by using a mouse monoclonal anti-phospho-serine antibody from Millipore-Sigma (Cat# P5747-25), and CoREST by using a rabbit polyclonal anti-CoREST antibody (EMD Millipore, Cat# 07–579). Left: Ratios of pSer-Nurr1/Nurr1 and CoRES/Nurr1 in Co-IP samples measured by densitometry of the Western blots. D, GFP expression in HC69 cells expressing either control shRNA (grey bars) and NIK shRNAs (green bars). Cells were untreated, induced with a high dose (400 pg/ml) of TNF-α for 24 hr, or continuously cultured in the absence of TNF-α for 48 hr (chase), in presence or absence of 1 μM 6-MP. The p-values of pair-sample, Student’s t-tests for differences in the numbers of GFP+ cells were calculated from three technical replicates. E, Western blot detection of Nef protein in cells treated as described in D. β-Tubulin was used as loading control.

Fig 4: Pan-caner expression lanscape of RCORs. (A) RCOR1, (B) RCOR2 and (C) RCOR3 expression levels among different cancer tissues. (D) RCOR1, (E) RCOR2 and (F) RCOR3 expression in different cancer tissues (blue) and adjacent non-tumor tissues (red). *p < 0.05, **p < 0.01, and ***p < 0.001.

Fig 5: Kaplan-Meier survival analysis of RCORs in different cancers. RCOR1 as a potential prognosis factor in ACC (A), KIRC (B), LAML (C) and PRAD (D); RCOR2 as a potential prognosis factor in LGG (E), MESO (F), UCEC (G), GBM (H) and UVM (I); RCOR3 as a potential prognosis factor in ACC (J).