Jagged1 (28H8) Rabbit mAb 2620S from Cell Signaling Technology

Product Specs
ItemJagged1 (28H8) Rabbit mAb
CompanyCell Signaling Technology
Price $336.00 Inquire
Catalog Number2620S
ClonalityMonoclonal
NCBI Full Gene Namejagged canonical Notch ligand 1
ApplicationsWB, IP
ReactivityHu, Ms
Research AreaDevelopmental Biology
IsotypeIgG
Clone28H8
Molecular Weight180
NCBI Gene AliasesAGS, AGS1, AHD, AWS, CD339, CMT2HH, DCHE, HJ1, JAGL1
HostRabbit
TargetJagged1
Quantity100 µl

Questions and Answers

Can this antibody be used to study Notch signaling in cancer research?

Yes, the Jagged1 (28H8) Rabbit mAb has been utilized in various studies related to Notch signaling in cancer. For instance, it was referenced in research examining the role of Jagged1 in the regulation of mammary epithelial stem cells and its impact on breast cancer progression, highlighting its relevance in oncogenic signaling pathways (Sizemore et al., 2017).

Is this antibody effective for detecting Jagged1 in different species?

The Jagged1 (28H8) Rabbit mAb is reactive to both human and mouse samples, making it suitable for comparative studies across these species. This cross-reactivity is beneficial for researchers studying the evolutionary aspects of Notch signaling or conducting experiments in mouse models of human diseases.

How has this antibody been applied in immunohistochemistry?

The Jagged1 antibody has been successfully employed in immunohistochemistry protocols to visualize Jagged1 expression in various tissues. For example, it was used in studies to assess Notch signaling components in vascular tissues, demonstrating its utility in examining the spatial distribution of Jagged1 in biological samples (Lin et al., 2024).

Are there any specific applications where this antibody has shown significant results?

This antibody has been shown to work effectively in Western blotting and immunoprecipitation applications, as evidenced by its use in studies investigating the interaction of Jagged1 with other signaling pathways, such as in the context of small cell lung cancer where Notch signaling was found to be modulated by MAPK pathway activation (Caeser et al., 2021).

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) Human receptive endometrial assembloid for deciphering the implantation windoweLifeApril 1, 2026Yu Zhang, Rusong Zhao, Chaoyan Yang, Jinzhu Song, Peishu Liu, Yan Li, Boyang Liu, Tao Li, Changjian Yin, Minghui Lu, et al.RRID:AB_629109,PLA (1:50) Antibody,Jagged1 (28H8) Rabbit mAb (Rabbit monoclonal),Cell Signaling,Cat#: 2620T RRID:AB_10693295,PLA (1:1000) Sequence-based reagent,PGR_F,This paper,PCR primers,ACCCGCCCTATCTCAACTACC Sequence-based

(2) Jagged1 regulates extracellular matrix deposition and remodeling in triple-negative breast cancerSci AdvMarch 20, 2026Marjaana Parikainen, Ujjwal Suwal, Pekka Rappu, Jyrki Heino, Cecilia M. SahlgrenThe following antibodies and dilutions were used: 1:1000 Jagged1 (Cell Signaling Technology, cat. no. 2620, RRID: AB_10693295), 1:1000 phospho-Smad2 (Ser465/467)/Smad3 (Ser423/425) (Cell Signaling Technology,

(3) EBF1 regulates sensory establishment in the cochlea by positioning the medial boundary of the prosensory domain and restricting proliferation of the sensory progenitor populationDevelopmentFebruary 1, 2026Kathryn G. Powers, Joshua Hahn, Juliette Wohlschlegel, Olivia Bermingham-McDonoghanti-EBF (C-8) Alexa Fluor-647 (Santa Cruz Biotechnology, sc137065-af647, 1:200), rabbit anti-JAG1 (Cell Signaling Technology, 2620, 1:125), sheep anti-PRDM16 (R&D Systems, af6295, 1:200), goat anti-SOX2 (R&D Systems, af2018, 1:200)

(4) Mechanosensitive interactions between Jag1 and Myo1c control Jag1 trafficking in endothelial cellsiScienceDecember 19, 2025Oscar M.J.A. Stassen, Noora Virtanen, Kai-Lan Lin, Freddy Suarez Rodriguez, Matthijs J.M. Heijmans, Feihu Zhao, Garry L. Corthals, Carlijn V.C. Bouten, Cecilia M. Sahlgrendilution)(Santa Cruz Biotechnology, sc-136544) and Jag1 (1:100 dilution) (Cell Signaling Technology, #2620). The cells were washed three times with PBS before incubating with Alexa 488 anti-rabbit secondary

(5) Remodelling of supernumerary leaflet primordia leads to bicuspid aortic valve (BAV) caused by loss of primary ciliaCardiovascular ResearchSeptember 29, 2025Ahlam Alqahtani, Lorraine Eley, Jake Newton, Kimberley Macdonald, Chloe Connolly, Cindy Rodrigues-Cleto, Kristyna Neffeova, Leonor Lopez, Javier Arias, Christopher J Derrick, et al.ab14106), cardiac Troponin I (HyTest; 4T21/2), Notch1ICD (Cell Signalling; 4147), Jagged1 (Cell Signalling; 2620), Notch2 (abcam; ab8296), Notch3 (abcam; ab23426), Lef1 (abcam; ab2230), Axin2 (abcam; ab32197), Caspase3

(6) Dynamic decoding of VEGF signaling and coordinated control of multiple phenotypes by the Src-TEM4-YAP pathwayCell SystemsJuly 16, 2025Sung Hoon Lee, Tae-Yun Kang, Xingbo Shang, Andre LevchenkoDLL4,Proteintech,"Cat# 21584-1-AP, RRID: AB_2878888" Rabbit monoclonal Jagged1 (28H8),Cell Signaling Technology,Cat# 2620; RRID: AB_10693295 Mouse monoclonal Jagged1,Proteintech,"Cat# 66890-1-Ig, RRID: AB_2882220" Mouse

(7) Protocol for tyramide signal amplification immunohistochemical detection of Notch1 signaling in the vascular systemSTAR ProtocolsDecember 20, 2024Ying Lin, Shekhar Singh, Chong Xu, Zeyu Wang, Cailin Feng, Dongyang Jiang, Lingfeng Luo, Weiming Li, Wenliang Che, Guofu ZhuRESOURCE,SOURCE,IDENTIFIER Antibodies,Antibodies,Antibodies ,, NICD (1:200),CST,4147S JAG1 (1:200),CST,2620S ERG (1:200),Abcam,ab92513 IB4 (1:100),Sigma,L2895 CDH5 (1:200),BD Pharmingen,555661 CDH5 (1:200),BD

(8) MEK/ERK signaling drives the transdifferentiation of supporting cells into functional hair cells by modulating the Notch pathwayStem Cells Translational MedicineJuly 15, 2024Jiaoyao Ma, Mingyu Xia, Jin Guo, Wen Li, Shan Sun, Bing ChenCleaved Notch1, 1:1000 dilution, #4147, Cell Signaling Technology), rabbit anti-JAG1(1:1000 dilution, #2620, Cell Signaling Technology), rabbit anti-HEY2 (1:500 dilution, #10597-1-AP, Proteintech), rabbit anti-HES5

(9) MUC1-C Dependence for the Progression of Pancreatic Neuroendocrine Tumors Identifies a Druggable Target for the Treatment of This Rare CancerBiomedicinesJuly 8, 2024Ozawa H, Haratake N, Nakashoji A, Daimon T, Bhattacharya A, Wang K, Shigeta K, Fushimi A, Fukuda K, Masugi Y, et al.CST), anti-mTOR (2983, 1:1000 dilution; CST), anti-NOTCH2 (5732, 1:1000 dilution; CST), anti-Jagged 1 (2620, 1:1000 dilution; CST), and anti-Histone H3 (ab1791, 1:5000 dilution; Abcam). 2.6. Cell Fractionation A

(10) Identification of MUC1-C as a Target for Suppressing Progression of Head and Neck Squamous Cell CarcinomasCancer Res CommunMay 14, 2024Nakashoji A, Haratake N, Bhattacharya A, Mao W, Xu K, Wang K, Daimon T, Ozawa H, Shigeta K, Fushimi A, et al.anti-NOTCH3 (5276T, 1:1,000 dilution, CST), anti-HEY1 (19929-1-AP, 1:2,000 dilution; Proteintech), anti-JAG1 (2620T, 1:1,000 dilution, CST), anti-DLL3 (2483S, 1:1,000 dilution, CST) and anti-β-actin (A5441, 1:10,000

(11) eNOS plays essential roles in the developing heart and aorta linked to disruption of Notch signallingDisease Models & MechanismsJanuary 1, 2024Lorraine Eley, Rachel V. Richardson, Ahlam Alqahtani, Bill Chaudhry, Deborah J. Henderson(HyTest; 4T21/2), Notch1ICD (Cell Signaling Technology; 4147), jagged 1 (Cell Signaling Technology; 2620), Dll4 (Santa Cruz Biotechnology; sc-28915) and versican (Merck, AB1032). After washing, sections were

(12) Notch Signaling Regulates the Function and Phenotype of Dendritic Cells in Helicobacter pylori InfectionMicroorganismsNovember 20, 2023Qiaoyuan Liu, Chuxi Chen, Yunxuan He, Wenhao Mai, Shipeng Ruan, Yunshan Ning, Yan LiConcentration,Source (Location) Rabbit monoclonal anti-Jagged1,1:1000,"Cell signaling, Danvers, MA, USACat. No. 2620S" Rabbit polyclonal anti-Dll4,1:1000,"Affinity, San Francisco, CA, USACat. No. DF13221" Anti-Dll1 antibody,1:1000,"Abcam,

(13) Molecular determinants of epithelial mesenchymal transition in mouse placenta and trophoblast stem cellScientific reportsJuly 6, 2023Jena SK, Das S, Chakraborty S, Ain R.Lab,A301-922A-T,1:1000 3,STAT3,CST,4904,1:2000 4,FOXC2,SCBT,sc-515472,1:250 5,BMP1,ABCAM,ab205394,1:500 6,ITGA5,CST,4705,1:1000 7,VCAN,ABCAM,ab19345,1:2000 8,COL3A1,SCBT,sc-514601,1:200 9,VIM,CST,5741s,1:1000 10,MSN,CST,3150S,1:1000 11,FN1,SCBT,sc-6952,1:250 12,WNT5B,ABCAM,ab93134,2.5:1000 13,JAG1,CST,2620T,1:1000 14,NOTCH1,CST,4147,1:1000 15,GAPDH,CST,14C10,1:4000 Sl. no.,Secondary antibody,Source,Cat.

(14) Defective jagged-1 signaling affects GnRH development and contributes to congenital hypogonadotropic hypogonadismJCI insightMarch 8, 2023Cotellessa L, Marelli F, Duminuco P, Adamo M, Papadakis GE, Bartoloni L, Sato N, Lang-Muritano M, Troendle A, Dhillo WS, et al.carried out on HEK293T cell lysates using antibodies anti-Jagged1 (28H8) (Cell Signaling Technology, 2620) and anti-Actin 1:5,000 (MilliporeSigma, A5060) as internal control. Western blot We have extracted

(15) Polymorphisms and gene expression of Notch4 in pulmonary tuberculosisFrontiers in ImmunologyFebruary 2, 2023Weijun Fang, Hua Liu, Lianhua Qin, Jie Wang, Xiaochen Huang, Sha Pan, Ruijuan Zhengdilution) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA); Rabbit anti-Jagged1 (2620, 1:000 dilution) from Cell Signaling Technology; Rabbit anti-GAPDH (SAB2701826) from Sigma. PGN were

(16) Human cytomegalovirus infection perturbs neural progenitor cell fate via the expression of viral microRNAsJournal of medical virologyFebruary 1, 2023Jiang X, Liu S, Fu YR, Liu XJ, Li XJ, Yang B, Jiang HF, Shen ZZ, Alemu EA, Vazquez P, et al.no. Primary antibodies,, IE1,Mouse monoclonal,"Merck, MAB810r" Jag1,Rabbit polyclonal,"Cell Signaling, 2620T" Nestin,Mouse monoclonal,"Thermo Fisher Scientific, MA1-110" Cas9,Mouse monoclonal,"Cell Signaling,

(17) ADAM12 is an independent predictor of poor prognosis in liver cancerScientific ReportsDecember 1, 2022Shuangqiu Du, Linlin Sun, Yun Wang, Wenhao Zhu, Jialin Gao, Wenjun Pei, Yao Zhanganti-ADAM12 (China ABclonal/A7940 1:2000), anti-ACTIN (US Sigma A1978 1:5000), anti-Jagged1 (US CST/2620S 1:1000), anti-Notch2 (China ABclonal/A0560 1:2000), anti-Hes1 (US CST/11988S 1:1000) and anti-TGF-β

(18) MIR4435-2HG in exosomes promotes gastric carcinogenesis by inducing M2 polarization in macrophagesFrontiers in OncologyNovember 22, 2022Chaofeng Li, Zhengju Chen, Jinli Gao, Tao Tang, Lei Zhou, Guochao Zhang, Dongdong Zhang, Chao Shen, Lei Guo, Tao Fu(Abcam; ab68153), p-STAT3 (Abcam; ab267373), JAK1 (CST; #29261), p-JAK1 (CST; #3331), Jagged1 (CST; #2620), Hes1 (CST; #11988), Hes5 (Abcam; ab194111), and β-actin (Abcam; ab8226). After initial incubation,

(19) Delineating cooperative effects of Notch and biomechanical signals on patterned liver differentiationCommunications BiologyOctober 7, 2022Ishita Jain, Ian C. Berg, Ayusha Acharya, Maddie Blaauw, Nicholas Gosstola, Pablo Perez-Pinera, Gregory H. Underhillprimary antibodies. Primary antibodies for Jagged1 (Cell Signaling, 3195T), E-cadherin (Cell Signaling, 2620T), and GAPDH (Cell Signaling, 2118S) were diluted 1/200, 1/200, and 1/1000, respectively, in TBS-T with

(20) MiR-378a-3p Acts as a Tumor Suppressor in Colorectal Cancer Stem-Like Cells and Affects the Expression of MALAT1 and NEAT1 lncRNAsFrontiers in OncologyJune 24, 2022Giorgia Castellani et al.Compass software (ProteinSimple). The following primary antibodies were used: 1:25 anti-Jagged-1 (#2620, Cell Signaling, Danvers, MA, USA), 1:30 anti-pAKT(Ser473)(#4058, Cell Signaling), 1:75 anti-AKT (#9272,

Be the First to Write a Review!

Jagged1 (28H8) Rabbit mAb

Jagged1 (28H8) Rabbit mAb from Cell Signaling Technology

Description

Questions and Answers

Cell Signaling Technology

Citations (70)

Reviews

Jagged1 (28H8) Rabbit mAb from Cell Signaling Technology

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map