FADS1 (7-RY13) Antibody sc-134337 from Santa Cruz Biotechnology, Inc.

Product Specs
ItemFADS1 (7-RY13) Antibody
CompanySanta Cruz Biotechnology, Inc.
Price $333.00Supplier Page View Company Product Page
Catalog Numbersc-134337
NCBI Gene AliasesTU12, FADSD5, D5D, LLCDL1, FADS6
Antibody TypePrimary Antibodies
Quantity100 µg/ml
Clone7-RY13
Reactivityhuman
Hostmouse
ClonalityMonoclonal
ApplicationsWB, IP, ELISA
Conjugate/TagUnconjugated
FormatPurified
NCBI Full Gene Namefatty acid desaturase 1
TargetFADS1
IsotypeIgG2a

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Polyunsaturated fatty acid biosynthesis pathway determines ferroptosis sensitivity in gastric cancerProceedings of the National Academy of Sciences of the United States of AmericaDecember 22, 2020Lee JY, Nam M, Son HY, Hyun K, Jang SY, Kim JW, Kim MW, Jung Y, Jang E, Yoon SJ, et al.antibodies: anti-β-actin (A5316, Sigma-Aldrich), anti-FADS1 (HPA042705, Atlas Antibodies; ab126706, Abcam; sc-134337, Santa Cruz Biotechnology; GTX114528, Genetex; 10627-1AP, Proteintech), anti-ELOVL5 (ab205535, Abcam;

(2) Embryonic fatty acid metabolism in diabetic pregnancy: the difference between embryoblasts and trophoblastsMolecular human reproductionNovember 1, 2020Schindler M, Dannenberger D, Nuernberg G, Pendzialek M, Grybel K, Seeling T, Navarrete Santos A.least 1 h. The primary antibody was incubated at 4°C overnight. Antibodies were purchased from FADS1 (#sc-134337, Santa Cruz, Germany, 1:1000), FADS2 (#AP22270a, Abgent, Germany, 1:1000), β-actin (#A5441Sigma-Aldrich,

(3) Impact of 17β-HSD12, the 3-ketoacyl-CoA reductase of long-chain fatty acid synthesis, on breast cancer cell proliferation and migrationCellular and molecular life sciences : CMLSMarch 1, 2020Tsachaki M, Strauss P, Dunkel A, Navrátilová H, Mladenovic N, Odermatt A.1:1000 dilution (Stressgen), GRP94 1:1000 dilution [28], FADS1 0.5 μg/ml (Santa Cruz Biotechnology, sc-134337), FADS2 0.5 μg/ml (Abcam, ab72189), G6PD 1 μg/ml (Bethyl Laboratories, TX, USA, A300-404A), PGD 1:1000

(4) Resveratrol Modulates Desaturase Expression and Fatty Acid Composition of Cultured HepatocytesFrontiers in nutritionJanuary 1, 2018Kühn G, Pallauf K, Schulz C, Birringer M, Diaz-Rica B, de Pascual-Teresa S, Rimbach G.synthase AAGGACCTGTCTAGGTTTGATGC TGGCTTCATAGGTGACTTCCA Statistics primary antibodies FADS1, FADS2, CPT1, GAPDH (sc-134337, sc-98480, sc-48357, and sc-20357, respectively; Santa Cruz Biotechnology Inc., Dallas, USA) and FASN

Be the First to Write a Review!

FADS1 (7-RY13) Antibody

FADS1 (7-RY13) Antibody from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (4)

Reviews

FADS1 (7-RY13) Antibody from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map