AclI from New England Biolabs

Product Specs
ItemAclI
CompanyNew England Biolabs
Price $75.00 Inquire
Catalog NumberR0598S
Concentration3 u/µL
Quantity300 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

AA/CGTT

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Unconventional binding of Calmodulin to CHK2 kinase inhibits catalytic activityBiochemical JournalDecember 3, 2025Christopher R. Horne, Tingting Wang, Samuel N. Young, Toby A. Dite, Hunter G. Nyvall, Sushant Suresh, Katherine A. Davies, Abner Gonzalez Castro, Vineet Vaibhav, Lucy J. Mather J., et al.Reverse: 5′- GGTGGTGTGCATCTGTAGTCCCAG -3′. The PCR product was digested with AclI (New England BioLabs, #R0598S) to confirm insertion of the ssODN. To validate the point mutation, PCR products were sequenced using

(2) Editing VvDXS1 for the creation of muscat flavour in Vitis vinifera cv. Scarlet RoyalPlant Biotechnology JournalJune 1, 2024Yingzhen Yang, Matthew Wheatley, Victoria Meakem, Erin Galarneau, Benjamin Gutierrez, Gan‐Yuan Zhongdigested by AclI in a 10 μL reaction (5 μL PCR product, 0.5 μL 10× SmartCut buffer, 0.3 μL AclI (NEB, R0598L), and 4.2 μL H2O) at 37 °C for 2 h. The PCR product digested with AclI was examined on a 1.2% agarose

(3) Epigenetic regulation of Sox4 during palate developmentEpigenomicsAugust 20, 2013Ratnam S Seelan, Partha Mukhopadhyay, Dennis R Warner, Cynthia L Webb, Michele Pisano, Robert M GreeneDNA methylation was assessed by digestion of the unmethylated and methylated plasmids with AclI (Cat. No. R0598S; New England BioLabs) and BstUI (Cat. No. R0518S; New England BioLabs). The plasmids were purified using

Be the First to Write a Review!

AclI

AclI from New England Biolabs

Sequence

New England Biolabs

Citations (3)

Reviews

AclI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map