AciI from New England Biolabs

Product Specs
ItemAciI
CompanyNew England Biolabs
Price $75.00 Inquire
Catalog NumberR0551S
Quantity200 units
Concentration5 u/µL
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

C/CGC + G/CGG

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Identifying Differentially Methylated Sites for Methylation-Sensitive qPCR-based NIPT of Trisomies 13 and 18Advanced Biomedical ResearchDecember 30, 2025Ali Najafi, Erfaneh Dastbaz, Artin Mehrabani, Morteza Rajabi, Ghazal Sedaghat Shayegan, Mohammad Miryounesi, Mohammad H. Modarressimethylation-sensitive restriction enzymes. The enzymes used in this study included AciI, HhaI, HpaII, and HpyCH4IV (R0551L, R0139S, R0171S, and R0619S, respectively; New England BioLabs™). This analysis was performed on DNA

(2) The Association of Lipoic Acid Synthase ( LIAS ) Gene Methylation With Diabetic Kidney DiseaseJournal of Diabetes ResearchNovember 28, 2025Ziyi Feng, Ting Liu, Peng Gao, Yongwei Jiang, Meimei Zhao, Yi Liu, Haoyan Zhu, Mo Li, Nan Li, Xiaomu Kong, et al.distinct recognition sequences were selected to increase the coverage of CpG sites: AciI (5′-CCGC-3′, R0551S, New England Biolabs, MA, United States), Hin6I (5′-GCGC-3′, FD0484, Thermo Fisher Scientific, MA, United

(3) Novel Grm6 Variant in a no b-wave (nob) Mouse Model: Phenotype Characterization and Gene TherapyInvestigative Ophthalmology & Visual ScienceSeptember 9, 2025Pei-Hsuan Lin, Eugene Yu-Chuan Kang, Neoklis Makrides, Winston Lee, Yun-Ju Tseng, Pei-Liang Wu, John Peregrin, Emmet Sherman, Jason Hunghsuan Wang, Theresa C. Swayne, et al.genotyping with the primers described above. After PCR, the 630 bp product was digested using Acil (R0551S, NEB Enzyme; New England Biolabs, Ipswich, MA, USA) with the addition of 1 µL of 10× Cutsmart buffer

(4) Protocol to detect m22G modification on single tRNA iso-decoders by immuno-northern blottingSTAR ProtocJuly 1, 2025Sseu-Pei Hwang, Katherine Barondeau, Catherine DenicourtmicroRNA marker,NEB,N2120S SYBR Gold nucleic acid gel stain,Invitrogen,S11494 "Glycogen, RNA grade",Thermo Fisher Scientific,R0551 Streptavidin magnetic beads,NEB,S1420S Exonuclease I,NEB,M0293S Amersham Hybond N+ nylon membrane,GE Healthcare

(5) Biomarkers of GH deficiency identified in untreated and GH-treated Pit-1 mutant miceFront Endocrinol (Lausanne)April 30, 2025Sarmed Al-Samerria, Huiting Xu, M. Elena Diaz-Rubio, Joseph Phelan, Chi Su, Keer Ma, Anna Newen, Kiana Li, Sayaka Yamada, Ariel L. Negron, et al.initially screened using PCR and digestion with the AciI restriction enzyme (NEB, Ipswich, MA, USA, Cat.No. R0551S), followed by confirmation through Sanger sequencing. Confirmed founders were then bred, and their offspring

(6) Identification of molecular determinants of gene-specific bursting patterns by high-throughput imaging screensMolecular CellMarch 6, 2025Varun Sood, Ronald Holewinski, Thorkell Andresson, Daniel R. Larson, Tom Mistelisamples were purified with phenol-chloroform extraction and ethanol precipitation with glycogen (Thermo #R0551) as carrier. ChIP-seq libraries were generated using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina®

(7) A prophage competition element protects Salmonella from lysisCell Host & MicrobeDecember 11, 2024Molly R. Sargen, Sophie HelaineLife Technologies,AM9722 Chloroform Isoamyl 24:1,Sigma,C0549 EDTA (0.5 M pH 8),VWR,10128-446 Glycogen RNA-Grade,Fisher,R0551 Phusion High-Fidelity DNA polymerase,NEB,M0530S TGIRT-III Enzyme,InGex,TGIRT-III Enzyme "T4 RNA ligase 2, truncated

(8) Improved methods for genetic manipulation of the alkaliphile Halalkalibacterium haloduransFrontiers in MicrobiologySeptember 18, 2024Freya D. R. Wencker, Seth E. Lyon, Ronald R. Breakerin vitro methylation of plasmid DNA as described in Figure 2A and in the text. Glycogen, RNA grade (#R0551, Thermo Fisher Scientific) was used to increase plasmid DNA precipitation. 2.5 Transformation of Halalkalibacterium

(9) Identification of molecular determinants of gene-specific bursting patterns by high-throughput imaging screensbioRxivJune 13, 2024Varun Sood, Ronald Holewinski, Thorkell Andresson, Daniel R. Larson, Tom Mistelisamples were purified with phenol-chloroform extraction and ethanol precipitation with glycogen (Thermo #R0551) as carrier. ChIP-seq libraries were generated using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina®

(10) Non-small Cell Lung Cancer Epigenomes Exhibit Altered DNA Methylation in Smokers and Never-smokersGenomics, Proteomics & BioinformaticsSeptember 22, 2023Jennifer A. Karlow, Erica C. Pehrsson, Xiaoyun Xing, Mark Watson, Siddhartha Devarakonda, Ramaswamy Govindan, Ting Wang[61]. MRE-seq was performed with four enzymes: HpaII, SsiI, Hin6I, and HpyCH4IV (Catalog Nos. R0171S, R0551S, R0124S, and R0619S, New England Biolabs, Ipswich, MA). A base offset of 3 was used during sequencing. Adapter

(11) Eliminating Malaria Vectors with Precision Guided Sterile MalesbioRxivJuly 26, 2023Andrea L. Smidler, Reema A. Apte, James J. Pai, Martha L. Chow, Sanle Chen, Agastya Mondal, Héctor M. Sánchez C., Igor Antoshechkin, John M. Marshall, Omar S. Akbari1114A.S41 (5’ CGGAAAGTTTATCATCCACTCTGAC 3’) primers, and the amplicon was digested with Acil (NEB cat#R0551S). To identify mutations by gRNAfle.7, the fle locus was amplified with the 1154A.S23 (5’ CTCAGCAAGCAGTATGCCAAC

(12) Regionalized Protein Localization Domains in the Zebrafish Hair Cell KinociliumJournal of Developmental BiologyJune 16, 2023Timothy Erickson, William Paul Biggers, Kevin Williams, Shyanne E. Butland, Alexandra VenutoBeverly, MA, USA, 2302830), and performing a NaCl-isopropanol precipitation with glycogen (Thermo Fisher, R0551) acting as an inert carrier. Biotinylated RNA was fragmented to approximately 200–500 bases using the

(13) Toll-like receptor 2-mediated downstream cytokine levels as determinant of malaria pathogenesisIndian Journal of Medical ResearchJune 7, 2023Manash Pratim Kalita, Tarun Kumar Basumatary, Subhash Medhi, Ramie Husneara Begumagarose gel. The PCR products (14 µl) were then digested with the restriction enzyme AciI (Cat. No-R0551S, New England Biolabs, USA) at 37°C, incubated overnight, and were then analyzed based on band pattern

(14) Induced hepatic stem cells maintain self-renewal through the high expression of Myc coregulated by TET1 and CTCFCell & BioscienceSeptember 2, 2022Chen Wang, Xinlu Yu, Sai Ding, Yang Liu, Hongxia Zhang, Jingbo Fu, Bing Yu, Haiying Zhurestriction endonuclease-PCR (MSRE-PCR) The genomic DNA extracted from cells was digested with AciI (R0551 V, New England BioLabs) and HpaII (R0171 V, New England BioLab), respectively. Genomic DNA digested

(15) Recruitment of Scc2/4 to double-strand breaks depends on γH2A and DNA end resectionLife Science AllianceMay 1, 2022Martin Scherzer, Fosco Giordano, Maria Solé Ferran, Lena Strömwith 80% EtOH, and resuspended in 50 μl of TE. 10 μl of each sample were digested with 10 U of AciI (R0551S; New England Biolabs) and 10 U MseI (R0525S; New England Biolabs) in a total reaction volume of 30 μl

(16) Mistranslation Reduces Mutation Load in Evolving Proteins through Negative Epistasis with DNA MutationsMolecular Biology and EvolutionOctober 27, 2021Jia Zheng, Ning Guo, Andreas Wagner°C overnight. After that, we precipitated the ligation product by adding 80 µl ddH2O, 1 µl glycogen (R0551, Thermo Scientific), 50 µl 7.5 M ammonium acetate (A2706-100ML, Sigma), and 375 µl ice-cold absolute

(17) DNA methylation patterns in juvenile systemic sclerosis and localized sclerodermaClinical ImmunologyJuly 1, 2021Patrick Coit, Kaila L. Schollaert, Emily M. Mirizio, Kathryn S. Torok, Amr H. SawalhaTo confirm proper CpG methylation, 200ng of plasmids were double digested with AciI (5’-C/CGC-3’) (R0551S; New England BioLabs; Ipswich, MA, USA), which is blocked by methylated CpG sites, and SacI-HF (5’-GAGCT/C-3’)

(18) Cis-Repression of Foxq1 Expression Affects Foxf2-Mediated Gene Expression in Palate DevelopmentFrontiers in Cell and Developmental BiologyApril 8, 2021Jingyue Xu, Han Liu, Yu Lan, Rulang Jiangamplified from wildtype, Foxf2+/–, and Foxf2–/– cDNA samples were digested overnight using AciI (NEB, R0551L) at 37oC. Quantification of the digested and undigested DNA fragments was performed by QIAxcel Advanced

(19) DNA length tunes the fluidity of DNA-based condensatesBiophysical journalApril 6, 2021Muzzopappa F, Hertzog M, Erdel F.KpnI (NEB, R0142); 3) AatII (NEB, R0117), BamHI (NEB, R3136), and KpnI (NEB, R0142); or 4) AciI (NEB, R0551), HindIII (NEB, R0104), and DraI (NEB, R0129). The 1 kb and 5 kb fragments were generated by PCR using

(20) High-throughput genotyping assays for identification of glycophorin B deletion variants in population studiesExperimental Biology and MedicineApril 1, 2021Dominic SY Amuzu et al.and 3b, with primers purchased from IDT (Leuven, Belgium). Restriction enzymes AciI (Catalog number: R0551L, NEB, UK) and BsrBI (Catalog number: R0102L, NEB, UK) were purchased (Table 4a). Reactions were prepared

Be the First to Write a Review!

AciI

AciI from New England Biolabs

Sequence

New England Biolabs

Citations (31)

Reviews

AciI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map