Renilla-Firefly Luciferase Dual Assay Kit HY-K1013 from MedChemExpress

Product Specs
ItemRenilla-Firefly Luciferase Dual Assay Kit
CompanyMedChemExpress
Price $315.00Supplier Page View Company Product Page
Catalog NumberHY-K1013
Quantity100 T
ApplicationsBioactivity, Structure and function analysis, ELISA, SDS-PAGE, Western blotting
Typekit

Add to Compare List

MedChemExpress

1 Deer Park Drive, Suite F

MONMOUTH JUNCTION, NJ 08852

United States

Phone: US Tel: 609-228-6898
US Fax: 609-228-5909
EU Tel: +4686500910

Email: sales@medchemexpress.com
eu.sales@MedChemExpress.com

Company Profile

Website: medchemexpress.com

(1) Long noncoding RNA X-inactive-specific transcript promotes hepatic fibrosis by suppressing ferroptosis in hepatic stellate cells via the miR-663a/GPX4 axisFrontiers in PhysiologyFebruary 11, 2026Jing Dai, Guo-Hui Zhong, Jun-Xing Yang, Xiao-Yu Tan, Dong Dai, Ming-Yi Litransfection period, the relative activity of luciferase was evaluated using the luciferase detection kit (HY K1013, MCE) to evaluate whether miR-663a had a targeted binding relationship with the 3′UTR of lncRNA-XIST

(2) A novel lncRNA RP11-544M22.13 enhances glycolysis-induced cisplatin resistance in non-small cell lung cancerCell Death DiscoveryNovember 27, 2025Jun Xiong, Haiyue Zhang, Zhou Pan, Yixuan Wang, Hui Chen, Mei Yangtransfection for 48 h, we measured luciferase activity using the Renilla-Firefly Luciferase Dual Assay Kit (HY-K1013, MCE). Chromatin immunoprecipitation (ChIP) ChIP analysis was performed in NSCLC cells to explore

(3) Integrative Transcriptome and Machine Learning Analysis Uncovers Critical STAT3/GREM2 Signaling Mechanisms in Dexamethasone Treatment of Hashimoto’s ThyroiditisACS OmegaNovember 25, 2025Huarong Zeng, Yingjie Chen, Tianchi Hu, Yi Zhou, Meimei Su, Lin Lin, Zhifu Keactivity was evaluated 48 h post-transfection using the Dual-Luciferase Reporter Assay Kit (MCE, Cat# HY-K1013–100T, China). 2.11 Quantitative Real-Time PCR Total RNA was isolated using TRIzol reagent (Invitrogen,

(4) Long Noncoding RNA TOB1‐AS1 Represses Cervical Cancer Cell Proliferation, Invasion, and Migration via the MicroRNA‐27a‐3p/Thioredoxin‐Interacting Protein Molecular AxisThe Kaohsiung Journal of Medical SciencesNovember 1, 2025Yang Wang, You‐Xiang Hou, Li Xie, Yi‐La Xia, Yi‐Na WangmiR‐27a‐3p mimics into HeLa and CaSki cells. Cells were lysed and detected by luciferase detection kit (HY K1013, MedChemExpress) 48 h subsequent to transfection. 2.11 Xenograft Tumor Model in Nude Mice Female BALB/c

(5) DDX5 super-enhancer promotes vasculogenic mimicry formation and metastasis in nasopharyngeal carcinoma by enhancing ADAM10 transcriptionCell Reports MedicineJune 17, 2025Tian Xia, Haimeng Yin, Qingwen Zhu, Kaiwen Zhang, Haijing Xie, Ying Shan, Siyu Zhang, Rui Zhu, Keying Li, Mengyu Miao, et al.transcriptional activity was determined using luciferase reporter assay as per the manufacturer’s protocol (HY-K1013, MCE, USA). In brief, 1–2×106 CNE2 cells were lysed with 500 μL lysis buffer. The cell lysate (20 μL)

(6) Resistance to anti-LAG-3 plus anti-PD-1 therapy in head and neck cancer is mediated by Sox9+ tumor cells interaction with Fpr1+ neutrophilsNat CommunApril 28, 2025Xiaocheng Wang, Maosheng Cheng, Shuang Chen, Caihua Zhang, Rongsong Ling, Shuqing Qiu, Ke Chen, Bin Zhou, Qiuli Li, Wenbin Lei, et al.luciferase activity was measured and analyzed using Renilla-Firefly Luciferase Dual Assay Kit (MCE, HY-K1013) according to the manufacturer’s instructions. Further details on reagents can be found in Supplementary

(7) Modulation of RASD2 by miRNA‐485‐5p Drives Thyroid Cancer Progression and MetastasisThe Kaohsiung Journal of Medical SciencesApril 28, 2025Xiao‐Yu Li, Jian‐Ping Sun, Hao Guo, Xiao‐Qing Fan, Shan‐Shan Zhang, Bo Wang, Na Yu, Qing‐Huai LinM). After 48 h, luciferase activities were measured using the Dual‐Luciferase Reporter Assay System (HY‐K1013, MedChemExpress). Renilla luciferase activity was normalized to firefly luciferase activity. Results

(8) HIC1 suppresses Tumor Progression and Enhances CD8+ T Cells Infiltration Through Promoting GSDMD‐induced Pyroptosis in Gastric CancerAdvanced ScienceApril 25, 2025Mengjie Kang, Wenqi Du, Lina Ding, Mengdi Wu, Dongsheng Peiactivity was subsequently measured using the Renilla‐Firefly Luciferase Dual Assay Kit (MCE, Cat. No.: HY‐K1013). The results were presented as the ratio of firefly luciferase activity to Renilla luciferase activity. Animal

(9) ZFP36 regulates the osteogenic differentiation of adipose-derived mesenchymal stem cells in osteoporosis by mediating KLF3 mRNA degradationSci RepApril 24, 2025Chao Liu, Ming Yi, Bangmin Luo, Ming Wang(11668019, Invitrogen, Carlsbad, CA, USA). Forty-eight hours after transfection, a dual luciferase (HY-K1013, MCE, Shanghai, China) reporter assay was performed, and luciferase activity was measured by a dual

(10) MicroRNA-155 Inhibition Activates Wnt/β-Catenin Signaling to Restore Th17/Treg Cell Balance and Protect against Acute Ischemic StrokeeNeuroFebruary 1, 2025Huang W, Hong Q, Wang H, Zhu Z, Gong S.24 h, quantitative fluorescence values were measured using the Dual-Luciferase Reporter Assay Kit (HY-K1013, MCE), and data analysis was performed using the SpectraMax M5 software (Molecular Devices; Zhao et

(11) Functional investigation of a novel ANKRD11 frameshift variant identified in a Chinese family with KBG syndromeHeliyonMarch 30, 2024Shuoshuo Wei, Yanying Li, Wanling Yang, Shuxiong Chen, Fupeng Liu, Mei Zhang, Bo Ban, Dongye Heand Renilla luciferase activities were measured using a Renilla-Firefly Luciferase Dual Assay Kit (HY–K1013, MedChemExpress, Germany) following the manufacturer's instructions on a GloMax® 20/20 Luminometer (Promega,

(12) Bi-directional regulation of type I interferon signaling by heme oxygenase-1iScienceMarch 15, 2024Miaomiao Wu, Yihui Fan, Lijuan Li, Junfa YuanKit,Takara,Cat#R22301 Quantitative PCR (RT-qPCR) Kit,Vazyme,Cat#Q71102 Renilla-Firefly Luciferase Dual Assay Kit,MedChemExpress,Cat#HY-K1013 DAPI,Beyotime,Cat#P0131 4% formaldehyde,Biosharp,Cat#BL539A ,, Experimental models: Cell lines,Experimental models

(13) Mast cell-derived exosomal miR-181a-5p modulated trophoblast cell viability, migration, and invasion via YY1/MMP-9 axisJournal of clinical laboratory analysisJuly 1, 2022Wang Y, Chen A.Promega). After 48‐h transfection, dual‐luciferase reporter assays were conducted by a dual‐luciferase kit (HY‐K1013; MedChemExpress). For ChIP assay, the primer of MMP‐9 is as follows: TATAGTTGGAAAATGGTAGAGTTGG, AATTACAAACATAAACCATAACACC.

Be the First to Write a Review!

Renilla-Firefly Luciferase Dual Assay Kit from MedChemExpress

Description

MedChemExpress

Citations (13)

Reviews

Renilla-Firefly Luciferase Dual Assay Kit from MedChemExpress

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map