Luna Universal One-Step RT-qPCR Kit E3005E from New England Biolabs

Product Specs
ItemLuna Universal One-Step RT-qPCR Kit
CompanyNew England Biolabs
Price $2,277.00 Inquire
Catalog NumberE3005E
Quantity2500 reactions
ApplicationsDNA Analysis, RT-qPCR
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Sex-related differences in cardiovascular inflammation and metabolomics in a humanized transgenic mouse model of celiac diseaseSci RepMarch 26, 2026Aline Pesi, Simon Lange, Fabian Schmitt, Manjusha Neerukonda, Michelle Wiegel, Theodora Petridou, Henning Ubbens, Lea Strohm, Dominika Mihalikova, Ivana Kuntic, et al.boundary-spanning primer sequences and the SYBR Green methodology using the Luna® Universal One-Step RT-qPCR Kit (E3005E, NEB, Ipswich, MA, US) on a Step One Plus sequence amplification system (Applied Biosystems, Foster

(2) Validation of Lung [18F]FDG Uptake as a Quantitative PET Biomarker for Influenza-Associated Pulmonary InflammationMolecular Imaging and BiologyDecember 1, 2025Carla Bianca Luena Victorio, Shantanu Gupta, Arun Ganasarajah, Joanne Ong, Ann-Marie Chackoone-step reverse transcription quantitative PCR (RT-qPCR) Luna Universal One-Step RT-qPCR Kit (NEB, Cat. #E3005E). Absolute quantification of copy numbers was performed using influenza A/PR/8/34 genomic RNA standards

(3) A Polyomavirus-Positive Merkel Cell Carcinoma Mouse Model Supports a Unified Origin for Somatic and Germ Cell CancersCancers (Basel)August 27, 2025Wendy Yang, Sara Contente, Sarah Rahmanwas performed using Luna one-step RNA-to-Ct RT-qPCR kit (New England Biolabs, Ipswich, MA, USA, Cat#E3005E), 5 µM gene-specific primer pairs, 5 ng RNA per final 20-µL RT-qPCR reaction, and the Azure Ciel 3 qPCR

(4) Dysfunctional mitochondria trap proteins in the intermembrane spaceThe EMBO JournalJune 16, 2025Tamara Flohr, Markus Räschle, Johannes M HerrmannQuick Coupled Transcription/Translation Kit,Promega,L2080 Luna Universal One-Step RT-qPCR Kit,NEB,E3005E Reagents and tools table

(5) A lineage-specific heat-induced feedback loop controls HrcA to promote chlamydial fitness under stressbioRxivJune 1, 2025Yehong Huang, Yuxuan Wang, Matthew Pan, Danny Wan, Lingling Wang, Joseph D. Fondell, Xiang Wu, Guangming Zhong, Huizhou Fan(Thermo Fisher Scientific) and the Luna Universal One-Step qRT-PCR Kit (New England BioLabs, catalog #E3005E) to quantify gene expression in Chlamydia trachomatis as described previously40,48. RNA samples stored

(6) Longitudinal multi-omics reveals pathogenic TSC2 variants disrupt developmental trajectories of human cortical organoids derived from Tuberous Sclerosis ComplexbioRxivOctober 15, 2024Weibo Niu, Shaojun Yu, Xiangru Li, Zhen Wang, Rui Chen, Christina Michalski, Arman Jahangiri, Youssef Zohdy, Joshua J Chern, Ted J Whitworth, et al.Direct-zol RNA Miniprep Kit (Zymo). qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E), following the manufacturer’s instructions. Each reaction was performed in triplicate and analyzed

(7) Broad susceptibility of Candida auris strains to 8-hydroxyquinolines and mechanisms of resistancemBioJuly 26, 2023Matthew B. Lohse, Matthew T. Laurie, Sophia Levan, Naomi Ziv, Craig L. Ennis, Clarissa J. Nobile, Joseph DeRisi, Alexander D. Johnsonfor RT-qPCR which was conducted using the Luna Universal One-Step RT-qPCR kit (New England Biolabs E3005E) on a C1000 touch thermal Cycler/CFX384 Real-Time System (Biorad). Reactions were performed in Hard-Shell

(8) A PCR protocol to establish standards for routine mycoplasma testing that by design detects over ninety percent of all known mycoplasma speciesiScienceMay 19, 2023Dominik Siegl, Marie Kruchem, Sandrine Jansky, Emma Eichler, Dorothe Thies, Udo Hartwig, Detlef Schuppan, Ernesto BockampUSA). Quantitative PCR (qPCR) qPCRs were performed using the Luna® Universal One-Step RT-qPCR Kit (E3005E, New England Biolabs, USA) with 2 μl extracted DNA solution in a total volume of 20 μl. In the positive

(9) Identification of DAXX as a restriction factor of SARS-CoV-2 through a CRISPR/Cas9 screenNature communicationsMay 4, 2022Mac Kain A, Maarifi G, Aicher SM, Arhel N, Baidaliuk A, Munier S, Donati F, Vallet T, Tran QD, Hardy A, et al.the inactivated supernatants or on extracted RNA using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005E) in a QuantStudio 6 thermocycler (Applied Biosystems) or in a StepOne Plus thermocycler (Applied Biosystems).

(10) Characterization and functional interrogation of the SARS-CoV-2 RNA interactomeCell reportsApril 26, 2022Labeau A, Fery-Simonian L, Lefevre-Utile A, Pourcelot M, Bonnet-Madin L, Soumelis V, Lotteau V, Vidalain PO, Amara A, Meertens L.Transfection System,Promega,Cat #E1200 Luna® Universal One-Step RT-qPCR Kit,New England Biolabs,Cat #E3005E Maxima First Strand cDNA Synthesis Kit,Thermo Fisher Scientific,Cat #K1671 ,, Experimental models:

(11) Humanized mice reveal a macrophage-enriched gene signature defining human lung tissue protection during SARS-CoV-2 infectionCell reportsApril 19, 2022Kenney DJ, O'Connell AK, Turcinovic J, Montanaro P, Hekman RM, Tamura T, Berneshawi AR, Cafiero TR, Al Abdullatif S, Blum B, et al.isolation kit,Stem Cell Technologies,17856 Luna® Universal One-Step RT-qPCR Lot,New England BioLabs,E3005E ,, Deposited data,Deposited data,Deposited data ,, Single cell RNA-seq raw data (NRGL/HNFL mice),GEO,GSE180063 Bulk

(12) Robust Heat Shock Response in Chlamydia Lacking a Typical Heat Shock Sigma FactorFrontiers in MicrobiologyJanuary 3, 2022Yehong Huang, Wurihan Wurihan, Bin Lu, Yi Zou, Yuxuan Wang, Korri Weldon, Joseph D. Fondell, Zhao Lai, Xiang Wu, Huizhou Fantranscription PCR (qRT-PCR) was performed using the Luna Universal One-Step RT-qPCR kit (NEB, Cat. # E3005E) following manufacturer’s instructions. For each reaction with the exception of 23S rRNA qRT-PCR reactions,

(13) Identification of a GrgA-Euo-HrcA Transcriptional Regulatory Network in ChlamydiamSystemsAugust 31, 2021Wurihan Wurihan et al.(5′AAATAGGCCCGTGTGATCCT3′). qRT-PCR was performed using Luna Universal one-step qRT-PCR kit (catalog no. E3005E; New England BioLabs [NEB]) following the manufacturer’s instructions. For each reaction, 10 ng of purified

(14) The mRNA derived MalH sRNA contributes to alternative carbon source utilization by tuning maltoporin expression in E. coliRNA BiologyJune 3, 2021Ira A. Iosub, Marta Marchioretto, Rob W. van Nues, Stuart McKellar, Gabriella Viero, Sander Grannemanpulse-over-expression and sRNA deletion experiments, the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E) was used according to the manufacturer’s instructions. The qPCRs were run on a LightCycler 480 (Roche),

(15) Hfq CLASH uncovers sRNA-target interaction networks linked to nutrient availability adaptationeLifeMay 1, 2020Ira Alexandra Iosub, Robert Willem van Nues, Stuart William McKellar, Karen Jule Nieken, Marta Marchioretto, Brandon Sy, Jai Justin Tree, Gabriella Viero, Sander Grannemanperformed on 10 ng of DNAse I-treated total RNA using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E) according to manufacturer’s instructions. The qPCRs were run on a LightCycler 480 (Roche), and the

Be the First to Write a Review!

Luna Universal One-Step RT-qPCR Kit

Luna Universal One-Step RT-qPCR Kit from New England Biolabs

Description

New England Biolabs

Citations (15)

Reviews

Luna Universal One-Step RT-qPCR Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map