Monarch RNA Cleanup Kit (50 g) T2040S from New England Biolabs

Product Specs
ItemMonarch RNA Cleanup Kit (50 g)
CompanyNew England Biolabs
Price $58.00 Inquire
Catalog NumberT2040S
Quantity10 preps
ApplicationsDNA Manipulation
Temperature25 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Multimodal profiling reveals cell type-specific pseudouridine modification and density-dependent translational regulationNucleic Acids ResApril 21, 2026Caroline A McCormick, Michele Meseonznik, Yuchen Qiu, Oleksandra Fanari, Priyanka Goyal, Mitchell Thomas, Mina Shokoufandeh, Yifang Liu, Dylan Bloch, Cole Greenfield, et al.Synthesis Kit (NEB, E2040S). IVT products were cleaned up using the Monarch Spin RNA Cleanup Kit (NEB, T2040L). mRNA concentration was measured using the Qubit RNA High Sensitivity Assay Kit (Thermo Fisher, Q32852)

(2) ACRC/GCNA is an essential protease that repairs DNA-protein crosslinks during vertebrate developmentNucleic Acids ResApril 20, 2026Cecile Otten, Marin Kutnjak, Christine Supina-Pavic, Marija Pranjic, Ivan Anticevic, Vanna Medved, Marta Popovic(#S1411, NEB) for improved mRNA stability. The resulting mRNA was purified using the RNA cleanup kit (#T2040, NEB) and injected into 1–2 cell stage acrc maternal mutant embryos or into control WT embryos (1 nl

(3) Hepatitis C Virus 5'UTR Sequences That Bind eIF3 and Ribosomal 40S Subunits Confer Stimulation of Minus-Strand RNA SynthesisInt J Mol SciApril 2, 2026Attiya Qadoos Malik, Lyudmila Shalamova, Mozhdeh Khajouei, Jonas Budnik, Anna-Lena Hell, Elena Jost, Gesche K. Gerresheim, Oliver Rossbach, Michael NiepmannKit (Invitrogen, Life Technologies GmbH, Darmstadt, Germany; C10365); Monarch RNA isolation kit (NEB T2040L); LunaScript RT Master Mix Kit (Primer-free) (NEB E3025L); Luna Universal qPCR Master Mix (NEB M3003);

(4) U2AF regulates the translation and localization of nuclear-encoded mitochondrial mRNAsMol CellApril 2, 2026Gloria R. Garcia, Murali Palangat, Josquin Moraly, Benjamin T. Donovan, Bixuan Wang, Ira Phadke, David Sturgill, Jiji Chen, Guofeng Zhang, Ronald J. Holewinski, et al.,Thermo Fisher,89874 EasyPep kit,Thermo Fisher,A40006 HiScribe T7 RNA synthesis kit,NEB,E2040S Monarch RNA cleanup kit,NEB,T2040L DNA Clean & Concentrator Kit,Zymo,D4003 HiScribe SP6 RNA synthesis kit,NEB,E2070S Nano-Glo Luciferase Assay

(5) Protocol for detecting in vitro riboswitch conformational switching using a fluorescence anisotropy single-stranded RNA-targeting approachSTAR ProtocMarch 19, 2026Amanda Clairoux, Maira Rivera, Maureen McKeague, Anthony MittermaierCleanup Kit (5 μg),New England Biolabs,#T1130S Monarch® Spin RNA Cleanup Kit,New England Biolabs,#T2040S ,, Software and algorithms,Software and algorithms,Software and algorithms ,, GraphPad Prism 9,GraphPad,N/A Gen5

(6) Mechanistic insights into the color transformation of a non-FRET substrate for RNase activity detectionbioRxivMarch 17, 2026Sohyun Kim, Soonwoo Hong, Jada N. Walker, Yujie He, Anh-Thu Nguyen, Wei-Ru Chen, Saeed Seifi, Yuan-I Chen, Yu-An Kuo, Jennifer S. Brodbelt, et al.additional 10–15 minutes. Lastly, the RNA product was purified using the Monarch RNA Cleanup Kit (NEB, Cat. #T2040), following the manufacturer’s protocol for <50 μg input. In vitro CRISPR/Cas13a reaction Recombinant

(7) HIV-1-encoded circular RNA enhances viral transcription through Tat bindingNature MicrobiologyMarch 13, 2026Prisca Obi, Lichong Yan, Adela Dujsikova, Yang-Hui Jimmy Yeh, Isabella Li, Noah L. Mueller, Hyein Back, Binbin Yi, Na Liu, Faith Mbadugha, et al.remove template DNA, RNAs were purified using the Monarch RNA Cleanup Kit (New England Biolabs, Cat. #T2040) and quantified by NanoDrop spectrophotometry. For RNA-protein binding assays, 0.5 pmol of biotinylated

(8) Ploidy and neuron size impact nervous system development and function in XenopusCell ReportsFebruary 24, 2026Xiao Liu, Christine Wan, Sara Aijaz Shah, Rebecca HealdDNase I (NEB #M0303S) at 37°C for 10 min, and RNA was purified using the Monarch RNA Cleanup Kit (NEB #T2040S). For RNA-seq, RNA quality control, library preparation (Kapa Biosystems library preparation kits with

(9) SUPT16H-associated neurodevelopmental disorder and neurocristopathy: genetic and phenotypic spectrumHuman Molecular GeneticsFebruary 23, 2026Eunhye Lee, Seungmin Sim, Hee-Jung Choi, Eugene Y. Liang, Carolyn Le, Roya Bina, Ryan Cohen, Elizabeth George, Soo Yeon Kim, Gifty Bhat, et al.RNA Synthesis Kit (E2050; New England Biolabs, Ipswich, MA, USA) and purified with the Monarch RNA Cleanup Kit (T2040; New England Biolabs). A 1 nl injection mixture containing 100 ng/μl sgRNA and 3.2 μg/μl Cas9 protein

(10) Sensitive, flexible, and affordable serum RNA sequencing for pathogen detection on the Oxford Nanopore platformBMC GenomicsFebruary 12, 2026Philippe Selhorst, Emilie Van Vyve, Francesca Falconi-Agapito, Joachim Mariën, Kevin K. AriënDTT, and overnight incubation. The produced sgRNAs were purified using the Monarch RNA cleanup kit (T2040, NEB), eluted in water or IDTE pH 7.5 buffer (11–01–02–02, IDT), and measured using the Qubit 4 broad

(11) Nuclear speckle proteins form intrinsic and MALAT1-dependent microphasesCellFebruary 5, 2026Min Kyung Shinn, Dylan T. Tomares, Vicky Liu, Avnika Pant, Yuanxin Qiu, Andreas Vitalis, You Jin Song, Yuna Ayala, Kiersten M. Ruff, Gregory W. Strout, et al.kit,Fisher,K210011 T7 mMESSAGE mMACHINE Transcription Kit,Fisher,M0255A Monarch RNA clean up,NEB,T2040L Biological samples,Biological samples,Biological samples Stage VI Xenopus laevis oocytes,Jonathan

(12) Targeting DAP5 Disrupts Alternate Mode of Translational Initiation in Tregs and Potentiates Antitumor ImmunityAdvanced ScienceFebruary 1, 2026Xiaojiang Lai, Guihong Pan, Xixi Feng, Jun Zhang, Yunxia Li, Shanmeizi Zhao, Zhenming Lin, Yun Feng, Wei Bao, Hongyan Yang, et al.NEBNext Magnesium RNA Fragmentation Module (NEB, Cat#E6150S) and purified with the Monarch RNA Cleanup Kit (NEB, #T2040L). The purified RNA fragments were dissolved in 100 µL IP buffer (RNase free H2O containing 1 M Tris‐HCl,

(13) 5′ UTR length regulates alternative N-terminal protein isoform production in health and diseasebioRxivJanuary 25, 2026Jimmy Ly, Eric M. Smith, Matteo Di Bernardo, Yi Fei Tao, Elizabeth M. Black, Ekaterina Khalizeva, Iain M Cheesemanmanufacturer’s instructions. RNA purification steps were performed using the Monarch Spin RNA Cleanup Kit (NEB, T2040) as recommended by the manufacturer. Purified mRNA was eluted in nuclease-free water, quantified using

(14) Inosine misincorporation into mRNA triggers the integrated stress response and activates an innate immune gene expression signaturebioRxivJanuary 21, 2026Jacob H. Schroader, Naa N. Adade, Emmanuel E. Adade, Mark A. Bratslavsky, Hannah K. Shorrock, Bradley R. Smith, Ting Zhou, Steven Lotz, Taylor Bertucci, Sally Temple, et al.treated with DNase I for an additional 15 min. RNAs were column-purified (NEB Monarch RNA Cleanup Kit #T2040L), eluted in nuclease-free H2O and stored at −80°C. Luciferase assay following mRNA transfections H9c2

(15) A guide to selecting high-performing antibodies for MMP7 (UniProt ID: P09237) for use in western blot and immunoprecipitationF1000ResearchJanuary 19, 2026Michael Biddle, Jemma Cooper, Carolyn Jones, Katie Dixon, Harvinder Virkphosphorylation respectively. RNA was purified using the Monarch spin RNA cleanup kit (New England Biolabs #T2040) and 125 ng of guide RNA (target sequence: TCAAAGGCTTTAAACATGTG) was combined with 625 ng of spCas9.

(16) A guide to selecting high-performing antibodies for Alpha-1-antitrypsin (UniProt ID: P01009) for use in western blot, immunoprecipitation and flow cytometryF1000ResearchJanuary 19, 2026Jemma Cooper, Carolyn Jones, Katie Dixon, Bibek Gooptu, Harvinder Virk, Michael Biddlephosphorylation respectively. RNA was purified using the Monarch spin RNA cleanup kit (New England Biolabs #T2040) and 125ng of guide RNA (target sequence: CACTCACGATGAAATCCTGG) was combined with 625ng of spCas9. Ribonucleoprotein

(17) A programmable ribozyme for RNA signal transductionNature CommunicationsJanuary 10, 2026Mandy Yu Theng Lim, Chermaine Tan, Charannya Sozheesvari Subhramanyam, Shi Jie Teo, Louis DeFalco, Samuel Kevin Pasaribu, Chong Hui Koh, Dheeraj Rayamajhi, Jieying Chi, Shengnan Li, et al.or DNA gene fragment (Twist Bioscience) before purification with a Monarch® Spin RNA Cleanup Kit (#T2040L, New England Biolabs). Cell-free cleavage assays were performed with 1 or 2.5 µM of ribozyme RNA and

(18) Binding of Glycyl-tRNA synthetase to Mengovirus RNA stimulates translationNucleic Acids ResearchJanuary 8, 2026Fabian Droß, Tim Gödert, Selena A Fuchshuber, Dimitar V Nachev, Dmitri E Andreev, Markus Fricke, Muriel Ritsch, Gesche K Gerresheim, Simeon Repp, Yannic Noe, et al.(proteintech No. 67893–1-Ig), GAPDH (Merck No. CB1001-500UG). Kits: NEB Monarch RNA isolation kit (NEB #T2040L). Non-standard chemicals: Biotin-X Hydrazide (Lumiprobe 2730), also called Biotinamidocaproyl hydrazide

(19) GacA uses two distinct regulatory mechanisms to control the biosynthesis of 2,4-diacetylphloroglucinol in Pseudomonas protegens Pf-5Applied and Environmental MicrobiologyDecember 23, 2025Maria Purnamasari, Marjana Ritu, Xiaogang Wu, Brian Tripet, Qing Yanincubated overnight at 37°C. The RNA was purified using the Monarch RNA Cleanup Kit (New England Biolabs, T2040L) following the manufacturer’s instructions. The purified RNA was quantified by measuring absorbance

(20) A novel plasmid-based co-tethered transcription platform for high yield, high purity mRNA synthesisNucleic Acids ResDecember 11, 2025Purnima Mala, Ruptanu Banerjee, Amin Abek, James Forster Iii, Aniruddha Pinjari, Ashish A Kulkarni, Craig T Martinand cell-based assays, we followed the protocol of the Monarch® Spin RNA Cleanup Kit (New England Biolabs, T2040S). mRNA storage All the mRNA desalted with the NEB cleanup kit was dissolved in the RNA storage buffer,

Be the First to Write a Review!

Monarch RNA Cleanup Kit (50 g)

Monarch RNA Cleanup Kit (50 g) from New England Biolabs

Description

New England Biolabs

Citations (183)

Reviews

Monarch RNA Cleanup Kit (50 g) from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map