Luna Universal Probe One-Step RT-qPCR Kit E3006L from New England Biolabs

Product Specs
ItemLuna Universal Probe One-Step RT-qPCR Kit
CompanyNew England Biolabs
Price $532.00 Inquire
Catalog NumberE3006L
Quantity500 reactions
ApplicationsDNA Analysis, RT-qPCR
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Synergistic Virus Neutralizing Activities of European Black Elderberry Fruit Extract and Iota-Carrageenan Against SARS-CoV-2, Influenza A Virus and Respiratory Syncytial VirusNutrientsApril 10, 2026Christian Setz, Melanie Setz, Pia Rauch, Oskar Schleicher, Stephan Plattner, Andreas Grassauer, Ulrich Schubertreal-time RT-PCR using the Luna Universal Probe One-Step RT-PCR Kit from New England Biolabs (Cat: E3006L, Ipswich, MA, USA). This kit allows reverse transcription, cDNA synthesis, and PCR amplification in

(2) Evaluation of beta-propiolactone and AVL-ethanol inactivation protocols for highly pathogenic avian influenza virus in allantoic fluid and cell cultureApplied and Environmental MicrobiologyMarch 18, 2026Natalia Pessoa, Nathalie Berube, Lauren Aubrey, Jill Van Kessel, M. Afzal Javed, Yan Zhouat −80°C. Quantitative RT-PCR was performed using 5 μL of RNA with the Luna Universal qPCR Kit (NEB, E3006L, Whitby, ON, Canada) on a StepOne Plus Real-Time PCR System (QuantStudio 3, Applied Biosystems) as described

(3) Accessory microRNA byproducts expand RNA interference via microprocessor-mediated cleavage activationSci AdvFebruary 13, 2026Debora Mazzetti, Michal O. Nowicki, Himanshu Soni, Joshua D. Bernstock, Maya Groff, Luisa Esposito, Diego A. Hernandez, Lucia Altucci, Anna Krichevsky, Geoffrey Fell, et al.added per PCR reaction and amplified using the Luna Universal Probe One-Step RT-qPCR Kit (catalog no. E3006L, New England Biolabs) following the manufacturer’s protocol. Primers used for the detection are listed

(4) Single-cell image-based screens identify host regulators of Ebola virus infection dynamicsNature MicrobiologyJuly 24, 2025Rebecca J. Carlson, J. J. Patten, George Stefanakis, Brian Y. Soong, Adityanarayanan Radhakrishnan, Avtar Singh, Naveen Thakur, Kathleen C. F. Sheehan, Gaya K. Amarasinghe, Nir Hacohen, et al.manufacturer’s instructions. RT-qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR kit (E3006L) on a Bio-Rad CFX Opus 96 Real Time PCR system. Primer/probe sequences for EBOV NP (forward- GCAGAGCAAGGACTGATACA,

(5) Approaches for inactivating highly pathogenic avian influenza H5N1 cattle isolate for safe containment level 2 laboratory practicesApplied and Environmental MicrobiologyMay 21, 2025Lauren Aubrey, Ulises Barron-Castillo, Nathalie Berube, Natalia Pessoa, Leslie Macas Jacome, Jill Trann, Andrew Gentes, Jill Van Kessel, Bryce Warner, Antonio Facciuolo, et al.microcentrifuge tube. Once extracted, 5 µL of the sample was subjected to qPCR with Luna qPCR Kit (NEB, E3006L, Whitby, ON, Canada) on the StepOne Plus Real-Time PCR System (QuantStudio6 Applied Biosciences) using

(6) Dairy cows develop protective immunity against reinfection with bovine H5N1 influenza virusNature MicrobiologyApril 17, 2025Antonio Facciuolo, Lauren Aubrey, Ulises Barron-Castillo, Nathalie Berube, Carla Norleen, Shannon McCreary, Yanyun Huang, Natalia Pessoa, Leslie Macas Jacome, Samira Mubareka, et al.50 μl of elution buffer. RT–qPCR was performed using the Luna qPCR kit (New England Biolabs (NEB), E3006L) and the StepOne Plus Real-Time PCR System (QuantStudio6, Applied Biosciences) using a primer probe

(7) Synergistic Antiviral Activity of European Black Elderberry Fruit Extract and Quinine Against SARS-CoV-2 and Influenza A VirusaNutrientsMarch 29, 2025Christian Setz, Pia Rauch, Melanie Setz, Stephan Breitenberger, Stephan Plattner, Ulrich Schubertquantified using the real-time PCR Luna Universal Probe One-Step RT-PCR Kit from New England Biolabs (Cat: E3006L, Ipswich, MA, USA). This kit allows the reverse transcription, cDNA synthesis, and PCR amplification

(8) Protocol for generating and characterizing a nasal epithelial model using imaging with application for respiratory virusesSTAR ProtocJanuary 7, 2025Victor H.K. Lam, Aleena Ghafoor, Yazan Khan, Shirley Constable, Lane B. Buchanan, David Zuanazzi, Reeya Parmar, Zeynep G. Tepe, Leigh J Sowerby, Cindy M. Liu, et al.TaqMan Fast Virus 1-Step Master Mix for qPCR,Applied Biosystems,Cat# 4444432 Luna Universal Probe One-Step RT-qPCR Kit,New England Biolabs,Cat# E3006L ,, Critical commercial assays,Critical commercial assays,Critical commercial assays ,, Human MUC5AC (Mucin 5 Subtype AC) ELISA Kit

(9) Impaired mucosal IgA response in patients with severe COVID-19Emerging Microbes & InfectionsDecember 31, 2024Melyssa Yaugel-Novoa, Blandine Noailly, Fabienne Jospin, Andrés Pizzorno, Aurélien Traversier, Bruno Pozzetto, Louis Waeckel, Stéphanie Longet, Sylvie Pillet, Elisabeth Botelho-Nevers, et al.nucleic acid extraction. The Luna Universal Probe One-Step RT-qPCR Kit from New England Biolabs (Ref. E3006L) [63] was used for this purpose. We diluted 5 μL supernatant 1/10 in DNase-free and RNase-free water.

(10) The West Nile virus genome harbors essential riboregulatory elements with conserved and host-specific functional rolesProceedings of the National Academy of SciencesJuly 16, 2024Nicholas C. Huston, Lucille H. Tsao, Doug E. Brackney, Anna Marie Pylegene, primers WNV1160F and WNV1229R, and the Luna Universal Probe One-Step RT-qPCR kit (NEB, Cat. No. E3006L). Using a linear regression derived from the standard curve, we calculated viral RNA genome copy number

(11) Single-cell image-based genetic screens systematically identify regulators of Ebola virus subcellular infection dynamicsbioRxivApril 11, 2024Rebecca J. Carlson, J.J. Patten, George Stefanakis, Brian Y. Soong, Adityanarayanan Radhakrishnan, Avtar Singh, Naveen Thakur, Gaya K. Amarasinghe, Nir Hacohen, Christopher F. Basler, et al.manufacturer’s instructions. RT-qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR kit (E3006L) on a Bio-Rad CFX Opus 96 Real Time PCR system. Primer/probe sequences for EBOV NP (forward- GCAGAGCAAGGACTGATACA,

(12) Transgene expression knock-down in recombinant Modified Vaccinia virus Ankara vectors improves genetic stability and sustained transgene maintenance across multiple passagesFrontiers in ImmunologyFebruary 6, 2024Patrick Neckermann, Madlen Mohr, Martina Billmeier, Alexander Karlas, Ditte R. Boilesen, Christian Thirion, Peter J. Holst, Ingo Jordan, Volker Sandig, Benedikt Asbach, et al.transcription quantitative PCR (RT-qPCR) was performed with Luna Universal Probe One-Step RT-qPCR kit (E3006L, NEB, Ipswich, USA) according to manufacturer’s instructions. 2 µl of total RNA extract were used on

(13) Direct BMP signaling to chordoblasts is required for the initiation of segmented notochord sheath mineralization in zebrafish vertebral column developmentFront Endocrinol (Lausanne)May 8, 2023Hans-Martin Pogoda, Iris Riedl-Quinkertz, Matthias Hammerschmidtand 260/230nm ratios. Gene expression was assayed using the Luna RT-qPCR Kit (New England Biolabs, E3006L) in combination with TaqMan assays (col2a1a (NCBI accession number XM_005166863.4: premade assay Dr03099270_m1;

(14) Preclinical safety and efficacy of a therapeutic antibody that targets SARS-CoV-2 at the sotrovimab face but is escaped by OmicroniScienceApril 21, 2023Kreye J, Reincke SM, Edelburg S, Jeworowski LM, Kornau HC, Trimpert J, Hombach P, Halbe S, Nölle V, Meyer M, et al.Kit,Analytic Jena,Cat#845-KS-4700250 Luna Universal Probe One-Step RT-qPCR kit,New England Biolabs,Cat#E3006L Membrane Proteome Array,Integral Molecular,N/A Human IgG ELISA development kit (ALP),Mabtech,Cat#3850-1AD-6 AdvanceBio

(15) Lipid Accumulation in Host Cells Promotes SARS-CoV-2 ReplicationVirusesApril 21, 2023Tatjana Seitz, Christian Setz, Pia Rauch, Ulrich Schubert, Claus Hellerbrandquantified by real-time PCR Luna Universal Probe One-Step RT-PCR Kit from New England Biolabs (Cat: E3006L, Ipswich, MA, USA). This kit allows reverse transcription, cDNA synthesis, and PCR amplification to

(16) Prior COVID-19 Immunization Does Not Cause IgA- or IgG-Dependent Enhancement of SARS-CoV-2 InfectionVaccines (Basel)March 31, 2023Melyssa Yaugel-Novoa, Blandine Noailly, Fabienne Jospin, Anne-Emmanuelle Berger, Louis Waeckel, Elisabeth Botelho-Nevers, Stéphanie Longet, Thomas Bourlet, Stéphane Paulby RT-PCR without nucleic acid extraction, with the Luna Universal Probe One-Step RT-qPCR Kit (Ref. E3006L, New England Biolabs, Ipswich, MA, USA) [19]. Briefly, 5 μL of supernatant was diluted 1/10 with Dnase-free

(17) High-efficiency purification of divergent AAV serotypes using AAVX affinity chromatographyMolecular Therapy - Methods & Clinical DevelopmentMarch 9, 2023Michael Florea, Fotini Nicolaou, Simon Pacouret, Eric M. Zinn, Julio Sanmiguel, Eva Andres-Mateos, Carmen Unzu, Amy J. Wagers, Luk H. VandenbergheAM1906) and then reverse transcribed and amplified using Luna Universal Probe One-Step qRT-PCR Kit (NEB, E3006L) according to the manufacturer’s instructions. Primer-probe sets for GFP cDNA (AGC AAA GAC CCC AAC GAG

(18) "A Monoclonal Human Alveolar Epithelial Cell Line (""Arlo"") with Pronounced Barrier Function for Studying Drug Permeability and Viral Infections"Advanced science (Weinheim, Baden-Wurttemberg, Germany)March 1, 2023Carius P, Jungmann A, Bechtel M, Grißmer A, Boese A, Gasparoni G, Salhab A, Seipelt R, Urbschat K, Richter C, et al.one‐step RT‐qPCR reaction was performed using the Luna Universal One‐Step RT‐qPCR Kit (New England Biolabs, E3006L) as well as a CFX96 Real‐Time System, C1000 Touch Thermal Cycler (Bio‐Rad). Primers, adapted from,[

(19) Characterization of Iflavirus in the Red Flour Beetle, Tribolium castaneum (Coleoptera; Tenebrionidae)InsectsFebruary 23, 2023Soheila Fatehi, Michael Aikins, Thomas W. Philips, Susan Brown, Kun Yan Zhu, Erin D. Scully, Yoonseong Parkregion of the polyprotein with the Luna Universal Probe One-Step RT-PCR kit (New England Biolabs, Cat # E3006L, Ipswich, MA, USA). Each 10 µL reaction contained 5 µL of Luna Universal Probe One-Step Reaction Mix

(20) Dual-gene detection in a single-tube system based on CRISPR-Cas12a/Cas13a for severe fever thrombocytopenia syndrome virusFront MicrobiolNovember 3, 2022Yating Zhu, Chen Xing, Li Yang, Qian Li, Xiaofeng Wang, Jing Zhou, Cong Zhang, Cuiping Ren, Fahu Liu, Jun He, et al.photographed. Quantitative real-time PCR detection We used Luna® Universal Probe One-Step RT-qPCR Kit (NEB, cat. no. E3006L) to perform the dual-channel qPCR detection (detecting the L gene in Hex channel and M gene in FAM channel)

Be the First to Write a Review!

Luna Universal Probe One-Step RT-qPCR Kit

Luna Universal Probe One-Step RT-qPCR Kit from New England Biolabs

Description

New England Biolabs

Citations (33)

Reviews

Luna Universal Probe One-Step RT-qPCR Kit from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map