pCas-Scramble from OriGene Technologies

Product Specs
ItempCas-Scramble
CompanyOriGene Technologies
Price $470.00Supplier Page View Company Product Page
Catalog NumberGE100003
Quantity10 µg
TypeCRISPR Vectors

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) Regulation of NTRK2 alternative splicing by PRPF40B controls neural differentiation and synaptic plasticityCell Death & DiseaseDecember 8, 2025María Duarte-Ruiz, Adela Moreno-Castillo, Younes El Yousfi, Cristina Moreno-Castro, Noelia Martínez-Martínez, Sandra Jiménez-Lozano, Marion Kennel, Candela Ruiz-Rodríguez, Alonso Rodríguez-Caparrós, Jennifer López-Ros, et al.were generated using the limiting dilution method. We also included a scrambled control gRNA (Origene, GE100003) to serve as a negative control. The shRNA target sequence used for SH-SY5Y sh7y(e) was CTAGAGGTTCTAGTCAAACAA

(2) Glycogen synthase kinase-3 activation and dysregulation of amyloid transport receptors expression and shedding in HIV-induced Alzheimer’s disease-like pathology: modulatory effects of CCR5 antagonistsActa Neuropathologica CommunicationsDecember 6, 2025Biju Bhargavan, Narendran Annadurai, Georgette D. Kanmogneprotocols. Negative controls included non-transfected cells and cells transfected with a scramble vector (GE100003, Origene). For CCR5 overexpression, generated stable CCR5-KO HBMEC were seeded at 0.5 × 106 cells/ml

(3) Hypoxia Induces Immunosuppression by Silencing STING in CancerCancer ResearchDecember 1, 2025Yuhong Lu, Annali M. Yurkevicz, Yanfeng Liu, Peter M. Glazer(OriGene Technologies, Inc. Cat#: KN517757 STING - KN2.0). pCAS-Scramble (OriGene Technologies, Inc, GE100003). BCAT1 expression vector was the Human Tagged ORF Clone (OriGene Technologies, Inc, Cat#: RC219229).

(4) Cathepsin B deficiency disrupts cortical development via PEG3, leading to depression-like behaviorCommun BiolJuly 23, 2025Zhen Xie, Qinghu Yang, Fei Lan, Wei Kong, Shuxuan Zhao, Jinyi Sun, Yan Yan, Zhenzhen Quan, Zhantao Bai, Hong Qing, et al.assessed by Q-PCR and immunoblotting. During the generation, we also included scramble control gRNA (SKU GE100003, ORIGENE, Cat#KN303984) to serve as a negative control. Positive clones were collected and cultured.

(5) CDX2 loss in colorectal cancer cells is associated with invasive properties and tumor buddingSci RepJuly 6, 2025Nils Bodmer, Kristin Uth, Rina Mehmeti, Cansaran Saygili Demir, Deborah Stroka, Nassim Ghaffari-Tabrizi-Wizsy, Alessandro Lugli, Olivier de Wever, Inti Zlobec, Mario P. Tschan(HGLibA_08899), CRISPR-Cas9-CDX2-gRNA2 (HGLibA_08898) (Zhang lab), and pCas-Scramble CRISPR Vector (Cat#: GE100003, Origene) contained a puromycin antibiotic-resistance gene for selection of transduced mammalian cells.

(6) Sodium pump subunit NKAα1 protects against diabetic endothelial dysfunction by inhibiting ferroptosis through the autophagy-lysosome degradation of ACSL4Clinical and translational medicineFebruary 1, 2025Zhu XX, Su JB, Wang FM, Chai XY, Chen G, Xu AJ, Meng XY, Qiu HB, Sun QY, Wang Y, et al.obtained from Thermo Fisher Scientific. NKAα1 human clone plasmid (RC201009) and scrambled plasmid (GE100003) were bought from ORIGENE. 4′,6‐Diamidine‐2′‐phenylindole dihydrochloride (DAPI) (C1002) and dihydroethidium

(7) PROL1 is essential for xenograft tumor development in mice injected with the human prostate cancer cell-line, LNCaP, and modulates cell migration and invasionJournal of Men's HealthMay 13, 2022Amarnath Mukherjee, Augene Park, Kelvin Paul Daviesvector (Catalog #: PS100093V, Origene Technologies) and a scramble CRISPR control vector (Catalog #: GE100003, Origene Technologies), respectively. Cell-lines were maintained in Roswell Park Memorial Institute

(8) Regulated IRE1α-dependent decay (RIDD)-mediated reprograming of lipid metabolism in cancerNature communicationsMay 6, 2022Almanza A, Mnich K, Blomme A, Robinson CM, Rodriguez-Blanco G, Kierszniowska S, McGrath EP, Le Gallo M, Pilalis E, Swinnen JV, et al.MDA-MB-231 cells MDA-MB-231 were transfected with CRISPR scramble guide RNA (gRNA) plasmid (OriGene, #GE100003) or gRNA targeting XBP1 sequence CCCGTCGGCCGGGTTCGGCG ((OriGene, #KN201959G2) in combination with the

(9) Targeted Self-Emulsifying Drug Delivery Systems to Restore Docetaxel Sensitivity in Resistant TumorsPharmaceuticsJanuary 26, 2022Campani V, Salaroglio IC, Nele V, Kopecka J, Bernkop-Schnürch A, Riganti C, De Rosa G.the CRISPR pCas vectors targeting MRP1 (#KN418182), BCRP (#KN405640), or the non-targeting vector (#GE100003) were purchased from Origene (Rockville, MD, USA). Anti-FGFR1 antibody (#ab58516) and anti-MRP1/ABCC1

(10) 2-Pentadecyl-2-oxazoline ameliorates memory impairment and depression-like behaviour in neuropathic mice: possible role of adrenergic alpha2- and H3 histamine autoreceptorsMolecular brainFebruary 8, 2021Boccella S, Guida F, Iannotta M, Iannotti FA, Infantino R, Ricciardi F, Cristiano C, Vitale RM, Amodeo P, Marabese I, et al.

(11) Gut-licensed IFNγ⁺ NK cells drive LAMP1⁺TRAIL⁺ anti-inflammatory astrocytesNatureFebruary 1, 2021Sanmarco LM, Wheeler MA, Gutiérrez-Vázquez C, Polonio CM, Linnerbauer M, Pinho-Ribeiro FA, Li Z, Giovannoni F, Batterman KV, Scalisi G, et al.sgStat1: 5′-GAGGAGGTCATGGAAGCGGA-3′, and sgScramble: 5′-GCACTACCAGAGCTAACTCA-3′ (sequence from Origene, GE100003). Isolation of mouse CNS cells CNS cells were isolated by flow cytometry as described4,16,20,22,25

(12) Core circadian clock transcription factor BMAL1 regulates mammary epithelial cell growth, differentiation, and milk component synthesisPloS oneJanuary 1, 2021Casey T, Suarez-Trujillo A, Cummings S, Huff K, Crodian J, Bhide K, Aduwari C, Teeple K, Shamay A, Mabjeesh SJ, et al.right homologous arms and green fluorescent protein-puromycin resistance gene functional cassette; and GE100003 scramble sequence in pCas-Guide vector. HC11 cultures in 6-well dishes were plated overnight and transfected

(13) Cathepsin B inhibition blocks neurite outgrowth in cultured neurons by regulating lysosomal trafficking and remodelingJournal of neurochemistryNovember 1, 2020Jiang M, Meng J, Zeng F, Qing H, Hook G, Hook V, Wu Z, Ni J.assessed by Q-PCR and immunoblotting. During the generation, we also included scramble control gRNA (SKU GE100003, ORIGENE, Cat#KN303984) to serve as a negative control. Positive clones were collected and cultured.

(14) Histone deacetylase inhibitors induce medulloblastoma cell death independent of HDACs recruited in REST repression complexesMolecular genetics & genomic medicineOctober 1, 2020Alshawli AS, Wurdak H, Wood IC, Ladbury JE.(OriGene, KN211570G1), pCas‐Guide2 (OriGene, KN211570G2), and the pCas‐Scramble negative control (OriGene, GE100003) were sequenced to confirm the correct insertion sequence. The transfection reactions were performed

(15) Loss of USF2 promotes proliferation, migration and mitophagy in a redox-dependent mannerRedox biologyOctober 1, 2020Chi TF, Khoder-Agha F, Mennerich D, Kellokumpu S, Miinalainen I, Kietzmann T, Dimova EY.

(16) TMBIM6/BI-1 contributes to cancer progression through assembly with mTORC2 and AKT activationNature communicationsAugust 11, 2020Kim HK, Bhattarai KR, Junjappa RP, Ahn JH, Pagire SH, Yoo HJ, Han J, Lee D, Kim KW, Kim HR, et al.was constructed using scrambled sequence (5′-GCACTACCAGAGGCTAACTCA-3′), which informed from Origene (#GE100003, pCas-Scramble Vector). The pRGEN_TMBIM6 vector or pRGEN_Scramble was mixed with pRGEN_Cas9-CMV and

(17) Temporal dynamics of protein complex formation and dissociation during human cytomegalovirus infectionNature communicationsFebruary 10, 2020Hashimoto Y, Sheng X, Murray-Nerger LA, Cristea IM.

(18) MAFG-driven astrocytes promote CNS inflammationNatureFebruary 1, 2020Wheeler MA, Clark IC, Tjon EC, Li Z, Zandee SEJ, Couturier CP, Watson BR, Scalisi G, Alkwai S, Rothhammer V, et al.sgMat2a: 5′-ACGAGGCGTTCATTGAGGAG-3′, and sgScramble: 5′-GCACTACCAGAGCTAACTCA-3′ (sequence from Origene, #GE100003). EAE EAE was induced as described13. All mice used were on the C57Bl/6 background. EAE was induced

(19) Environmental Control of Astrocyte Pathogenic Activities in CNS InflammationCellJanuary 24, 2019Wheeler MA, Jaronen M, Covacu R, Zandee SEJ, Scalisi G, Rothhammer V, Tjon EC, Chao CC, Kenison JE, Blain M, et al.sgEif2ak3: 5’-gCTTTGAACTTCGGTATATTC-3’, and sgScramble: 5’-gGCACTACCAGAGCTAACTCA-3’ (sequence from #GE100003, Origene). Transfections and luciferase assays HEK-293 cells (ATCC, #CRL-1573) were grown in DMEM/F12+GlutaMAX

(20) Collagen IV (COL4A1, COL4A2), a Component of the Viral Biofilm, Is Induced by the HTLV-1 Oncoprotein Tax and Impacts Virus TransmissionFrontiers in microbiologyJanuary 1, 2019Millen S, Gross C, Donhauser N, Mann MC, Péloponèse JM Jr, Thoma-Kress AK.

Be the First to Write a Review!

pCas-Scramble

pCas-Scramble

pCas-Scramble from OriGene Technologies

Description

OriGene Technologies

Citations (21)

Reviews

pCas-Scramble from OriGene Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map