pCMV6-AN-mRFP Mammalian Expression Vector from OriGene Technologies

Product Specs
ItempCMV6-AN-mRFP Mammalian Expression Vector
CompanyOriGene Technologies
Price $670.00Supplier Page View Company Product Page
Catalog NumberPS100049
Quantity10 µg
TypeMammalian Expression Vectors
Conjugate/Tag/Label (standardized)RFP tag
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Selectable MarkerAmpicillin (100 ug/mL)
Conjugate/Tag/LabelmRFP
ResistanceNeomycin

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) SLC38A9 is directly involved in Tat-induced endolysosome dysfunction and senescence in astrocytesLife science allianceJuly 1, 2025Rezagholizadeh N, Datta G, Hasler WA, Nguon EC, Smokey EV, Khan N, Chen X.37°C. In the colocalization study, human astrocytes were transfected with a SLC38A9-RFP plasmid (Cat# PS100049; OriGene). After 48 h, the cells were treated with 100 nM FITC-labeled Tat protein (Cat# 1002-F; ImmunoDX)

(2) TLR7 Mediates HIV‐1 Tat‐Induced Cellular Senescence in Human AstrocytesAging CellApril 30, 2025Neda Rezagholizadeh, Gaurav Datta, Wendie A. Hasler, Erica C. Nguon, Elise V. Smokey, Xuesong Chenof Tat with TLR7, human astrocytes were transfected with a plasmid encoding TLR7‐RFP (Origene, cat#PS100049). 48 h post‐transfection, the cells were incubated with FITC‐labeled HIV‐1 Tat protein (4 μg/mL, ImmunoDX,

(3) Cancer-Associated SF3B1 Mutations Confer a BRCA-Like Cellular Phenotype and Synthetic Lethality to PARP InhibitorsCancer researchMarch 1, 2022Lappin KM, Barros EM, Jhujh SS, Irwin GW, McMillan H, Liberante FG, Latimer C, La Bonte MJ, Mills KI, Harkin DP, et al.- ACCATACAGCTTCATAAATAA Plasmids pCMV6-AN-Myc-DDK (PS100016; RRID:SCR_021264) and pCMV6-AN-mRFP (PS100049; RRID: SCR_021265) were purchased from Origene. Inducible GFP-RNAseH1 plasmid was generated via restriction

(4) The PRR14 heterochromatin tether encodes modular domains that mediate and regulate nuclear lamina targetingJournal of cell scienceMay 27, 2020Dunlevy KL, Medvedeva V, Wilson JE, Hoque M, Pellegrin T, Maynard A, Kremp MM, Wasserman JS, Poleshko A, Katz RA.to N-terminal mGFP and mRFP vectors from OriGene (pCMV6-AN-mGFP, cat# PS100048; pCMV6-AN-mRFP, cat# PS100049) via the Origene PrecisionShuttle system using SgfI and MluI restriction sites. The N-terminal full-length

(5) Efficient protein knockdown of HaloTag-fused proteins using hybrid molecules consisting of IAP antagonist and HaloTag ligandBioorganic & medicinal chemistryJuly 15, 2016Tomoshige S, Hashimoto Y, Ishikawa M.

Be the First to Write a Review!