Ready Made™ Primers from Integrated DNA Technologies

Product Specs
ItemReady Made™ Primers
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number51-01
TypePrimers

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Intestinal inflammation promotes neuroinflammation and PD-associated nigrostriatal pathology independently of LRRK2 G2019S kinase activityFront Cell NeurosciApril 10, 2026Andrea R. Merchak, Mary K. Herrick, Madelyn C. Houser, Cody E. Keating, Jianjun Chang, Malú Gámez TanseySuperScript II Reverse Transcriptase (Life Technologies, 18064014), random hexamers (Integrated DNA Technologies, 51-01-18-25), and dNTPs (Life Technologies, 18427013). qPCR was performed as previously described (de Sousa

(2) ZO-2 determines cell membrane localization of receptor NTCP and supports hepatitis B virus infectionmBioApril 8, 2026Hironori Nishitsuji, Saori Yoshimura, Daijiro Konno, Taro Tachibana, Masaya Sugiyama, Manabu Yamasaki, Masashi Mizokami, Takayuki Murata, Kunitada Shimotohnomanufacturer’s protocol. Negative control siRNA was purchased from Integrated DNA Technologies (Cat# 51-01-14-04). Target sequences of siZO-1, siZO-2, siZO-3, siSDC4, siTFRC, siSTT3A, and siSTT3B are as follows: siZO-1,

(3) Reticulon-1 synthesis controls outgrowth and microtubule dynamics in injured cortical axonsLife Science AllianceApril 1, 2026Alejandro Luarte, Javiera Gallardo, Daniela Corvalán, Ankush Chakraborty, Cláudio Gouveia Roque, Francisca Bertin, Carlos Contreras, Juan Pablo Ramírez, André Weber, Waldo Acevedo, et al.3,5′rGrUrGrGrUrUrUrCrGrArUrGrUrUrUrArCrUrCrUrArCrCTG3′,5′rCrArGrGrUrArGrArGrUrArArArCrArUrCrGrArArArCrCrArCrArG3′ IDT Negative Control DsiRNA (51-01-14-03),, Oligonucleotides

(4) Chromatin dynamics of the Klf4 locus in mouse pluripotent cellsScientific ReportsMarch 27, 2026Jente van Staalduinen, Hélène Kabbech, Selçuk Yavuz, Ridvan Cetin, Agnese Loda, Wiggert van Cappellen, Adriaan Houtsmuller, Kerstin Wendt, Ihor Smal, Frank GrosveldAM1907). Hereafter, 1 µg of RNA was converted to cDNA using 1 μl of 50 µM Oligo d(T)20 (IDT, Catalog no: 51-01-15-01) or 50 µM random hexamers (IDT, Catalog no: 51-01-18-01) using the SuperScript IV Reverse Transcriptase

(5) Mitoregulin supports mitochondrial membrane integrity and protects against cardiac ischaemia–reperfusion injuryCardiovascular ResearchMarch 26, 2026Colleen S Stein, Xiaoming Zhang, Nathan H Witmer, Edward Ross Pennington, Scott Hahn, Adam C Straub, Saame Raza Shaikh, Ryan L Boudreautool. Cells were transfected with 50 nM Mtln-directed (siMtln) or negative control (siCtrl) (IDT cat# 51-01-14-03) dsiRNA oligos, using Lipofectamine Ltx (Invitrogen) according to product instructions. At 48

(6) Protocol for validating computationally predicted splice-altering variants using full-length gene reporter assaysSTAR ProtocMarch 20, 2026Maria E. Lukes, Kostantin Kiianitsa, Anthony Widjaja, Olena Korvatskalines ,, HMC3,ATCC,CRL-3304 HEK293T,ATCC,CRL-3216 THP-1,ATCC,TIB-202 BV2,Cellosaurus,CVCL_0182 ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, Anchored Oligo dT (22) (cDNA),Integrated DNA Technologies,Cat# 51-01-15-09 APOE Exon 1 F (RT-PCR) CAGCGGAGGTGAAGGACGT,Xu et al.6,N/A APOE Exon 4 R (RT-PCR) TTGTTCCTCCAGTTCCGATTTGTA,Xu

(7) Modified Polycyclic Compounds Rescue Mis-splicing in Myotonic Dystrophy Type 1 Disease ModelsACS Chemical BiologyMarch 20, 2026Jesus A. Frias, Sawyer M. Hicks, Hormoz Mazdiyasni, Subodh K. Mishra, Kahini Sarkar, Clara Yeboah, Noah M. LeFever, Marina M. Scotti, Hana Zeghal, Naomi Brandt, et al.made: total RNA input varied from 100 to 500 ng, 50 μM random hexamers were sourced from IDT (cat. no. 51-01-18-26), and a 30 min 50 °C incubation time was used. The resulting cDNA was used for polymerase chain reaction (PCR

(8) A CRISPR-Cas13d cancer therapeutic enables selective elimination of uveal melanomaMolecular Therapy OncologyMarch 19, 2026Daniel Stauber, Lucas Sosnick, Yitong Ma, Sopida Pimcharoen, Atip Lawanprasert, Niren Murthy, David Myung, Lei S. Qi(Zymo, #R1055), and then reverse-transcribed (NEB, #E3010) with an anchored oligo-dT primer (IDT, #51-01-15-08). The qPCR reactions were performed using a standard SYBR-Green-based system (Bio-Rad SsoAdvanced

(9) Evaluating the new product Norroa™ against Varroa destructor in managed honey bee (Apis mellifera) coloniesFront Insect SciMarch 11, 2026Devan Rawn, Cody Prouty, Asmita Gautam, Matthew Jamison, Win Talton, Katie Youngs, Ken Narva, Brian Manley, Cameron JackM-MuLV Reverse Transcriptase (NEB, Cat. No. M0253L) was used in combination with Oligo -d(T)20VN (IDT, Cat. No. 51-01-15-08) for cDNA synthesis. qPCR was performed using Maxima SYBR Green 2x Master Mix (ThermoFisher, Cat.

(10) RNA localization to nuclear speckles follows splicing logicNucleic Acids ResMarch 6, 2026Li Wen, Mauricio A Arias, Xinqi Fan, Joyce Xie, Sneha Paul, Susan E Liao, Marek Sobczyk, Oded Regev, Jingyi Fei(hs.Ri.U2AF1.13.2), U2AF2 (hs.Ri.U2AF2.13.2), SRSF1 (hs.Ri.SRSF1.13.2), as well as a scrambled negative control (51-01-19-08) were purchased from IDT. For each well of an 8-well chamber, the siRNA–lipid complex was prepared

(11) PFKM governs metabolic shifts throughout skeletal muscle differentiationNature MetabolismFebruary 24, 2026Melissa Campos, Steven T. Nguyen, Xiangduo Kong, Ying Yang, Richard L. Watson, Anastasia Gromova, Catherine R. Livelo, Carolina N. Franco, Julia E. Cabral, Laurence J. Seabrook, et al.for human PFKM that targets the 3′ untranslated region (hs.Ri.PFKM.13.1) and Negative Control DsiRNA (51-01-14-03) were purchased from Integrated DNA Technologies. Immunoblotting Cell lysates were prepared

(12) TFAM-Mediated mtDNA Replication is Essential for Developmental Competence of In Vitro Grown OocytesReprod Med BiolFebruary 23, 2026Son Quang Do, Hidetaka Tasaki, Hiroaki Funahashi, Takuya WakaipL of 2 μM DsiRNA targeting Tfam (mm.Ri.Tfam.13.1, IDT, Iowa, USA) or 2 μM negative control DsiRNA (51–01–14‐03, IDT, Iowa, USA) directly into the ooplasm. Follicles were cultured on Millicell culture inserts

(13) Intercellular Communication via Mitotic Nanotubes is Influenced by Connexin-43 Trafficking and Actin RemodelingbioRxivFebruary 11, 2026A. Cooper, S. Cetin-Ferra, K.A. Yonosh, A. Hinton, A. Marshall, J. R. Faeder, S.A. Murrayexperiments, cells were transfected with either control (non-targeting) siRNA (IDT, Coralville, IA, #51-01-14-04) or siRNA targeted to human GJA1 (Cx43) gene (IDT, Coralville, IA, #hs.Ri.GJA1.13.1). Cells in

(14) Domain-selective folding of the tandem β-propeller protein Coronin 7 (Coro7) by the chaperonin CCT/TRiCJournal of Biological ChemistryFebruary 6, 2026DeHaven J. McCrary, Teri Naismith, Silvia JansensgsgRNA,Sequence, HEK293T Coro7 Knockout,5′ - ccatgaacgcttccagggtgtcc - 3′, siRNA,Sequence, Scrambled (IDT),# 51–01–14–03, siCCT2 (IDT),GAUGGUGCCACUAUUCUAAAAAACA, siCCT2 (IDT),UACUACCACGGUGAUAAGAUUUUUUGU, Primer,Sequence,Plasmid F

(15) Integrative functional genomics analysis identifies pleiotropic genes for vascular diseasesNature CommunicationsFebruary 5, 2026Charles U. Solomon, David G. McVey, Catherine Andreadi, Peng Gong, Lenka Turner, Dedrick S. S. Song, Heming Zhang, Dominic P. Lee, Elisavet Karamanavi, Wei Yang, et al.Technologies, sequence described in Supplementary 33) or negative control DsiRNA (Integrated DNA Technologies, 51-01-14-04), with 3 technical replicates. At 0, 24, and 48 hours post-transfection, cells were subjected

(16) m6A RNA methylation modulates antiviral response in celiac diseaseGenes & ImmunityJanuary 10, 2026Maialen Sebastian-delaCruz, Ane Olazagoitia-Garmendia, Izei Pascual-Gonzalez, Luis Manuel Mendoza, Maria Legarda, Carlos Tutau, Luis Bujanda, Sankar Ghosh, Izortze Santin, Thomas S. Postler, et al.hs.Ri.ALKBH5.13.3), METTL3 (IDT, #hs.Ri.METTL3.13.1 and #hs.Ri.METTL3.13.2) or negative control siRNA (IDT, #51-01-14-01) were used. For silencing experiments, 150,000 cells/well were seeded and 30 nM and 60 nM of siRNAs

(17) Regulatory role for tumor suppressor REST on estrogen receptor (ESR1) expression and leiomyoma pathophysiologyJournal of Biological ChemistryJanuary 1, 2026Skylar G. Bird, Sumedha Gunewardena, Ashley Cloud, Sornakala Ganeshkumar, Vargheese M. ChennathukuzhisiRNA (IDT, #595797061), respectively. Control wells included negative control DsiRNA (DS NC-1, IDT, #51-01-14-04). The plate was incubated at 37 °C 5% CO2 with the complexes for 48 h. At the conclusion of the

(18) Ubiquitin-Specific Protease 20 Promotes CCCP-Induced Mitophagy Through Deubiquitination and Stabilization of Serine/Threonine Protein Kinase PINK1J Mol NeurosciDecember 13, 2025Ga Hyun Park, Hye In Park, Donghyuk Shin, Kwang Chul Chung(Bionics, Seoul, Korea). Small interfering RNAs (siRNAs) for USP20 and control scrambled siRNA (cat. #51-01-14-04) were purchased from Integrated DNA Technologies (Hanam-si, Gyeonggi-do, Korea). The USP20-specific

(19) The human chromatin remodeling complex p400 restricts HIV-1 transcription in a Tat-dependent mannerNucleic Acids ResDecember 11, 2025Chuan Li, Yuan Ma, Luisa P Mori, Huiming Yang, Yi Wang, Thomas T Venables, Ronald Bronson, Ryan R Milione, Mathew E Pipkin, Susana T Valenteand Unipolar. 27mer, Dicer-substrate RNAs (DsiRNA) were predesigned and ordered from IDT. siScramble: 51-01-19-09; siEP400: GCAUACAAUGGACUUUCUUAUCUUUAGAAAGUCCA; siBRD4-1: ACCGAGAUCAUGAUAGUCUUGCCUGGACUAUCAIGA;

(20) MicroRNA-21 is a potential therapeutic agent targeting Tgfbi and mitigating high-fat-diet-induced liver disease and cancerMolecular Therapy Nucleic AcidsDecember 9, 2025Urmila Jagtap, Anan Quan, Yuho Ono, Jonathan D. Lee, Alice Rodrigues, Kylie A. Shen, Sergei Manakov, Gyongyi Szabo, Imad Nasser, Frank J. Slackinto three treatment groups: (1) NC inhibitor (Qiagen, GeneGlobe ID: YM00479902-ADA) + NC siRNA (IDT, 51-01-14-03), (2) NC siRNA + miR-21 inhibitor (Qiagen, GeneGlobe ID: YI04100689-DDA), and (3) miR-21 inhibitor

Be the First to Write a Review!

Ready Made™ Primers from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (233)

Reviews

Ready Made™ Primers from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map