SimpleChIP ® Human Sat2 Repeat Element Primers from Cell Signaling Technology

Product Specs
ItemSimpleChIP ® Human Sat2 Repeat Element Primers
CompanyCell Signaling Technology
Price $131.00 Inquire
Catalog Number5077S
ReactivityH
ApplicationsChIP
Quantity500 µl
TargetSat2
NCBI Full Gene Namespermidine/spermine N1-acetyltransferase family member 2
NCBI Gene AliasesSSAT-2, SSAT2
TypePrimers

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) The protective role of MC1R in chromosome stability and centromeric integrity in melanocytesCell Death DiscoveryJune 1, 2021Xin Li, Weiwei Mao, Jie Chen, Colin R. Goding, Rutao Cui, Zhi-Xiang Xu, Xiao Miao5′AAGGTCAATGGCAGAAAAGAA and 5′CA ACGAAGGCCACAAGATGTC. Sat2 primers were purchased from Cell Signaling Technology (Cat. #5077 S). Li et al. Cell Death Discovery (2021)7:111 Co-immunoprecipitation Co-IP of Mitf and CENP-A

(2) A Dual-Band Focal Plane Array of Kinetic Inductance Bolometers Based on Frequency-Selective AbsorbersIEEE Transactions on Terahertz Science and TechnologyNovember 1, 2018Shahab Oddin Dabironezare, Juha Hassel, Erio Gandini, Leif Gronberg, Hannu Sipola, Visa Vesterinen, Nuria Llombartnetwork for linearly polarized THz absorbers,” IEEE Trans. on Antennas and Propag., vol. 62, no. 10, pp. 5077–5088, Oct. 2014. B. Munk, Frequency Selective Surfaces Theory and Design, WileyInterscience, 2000. CST

(3) PARAFFIN PROBLEM TREATING ALONG THE FLOWLINE (STUDY CASE: FROM WELLHEAD â€œXâ€ TO THE SEPARATORâ€)SINERGIJune 27, 2018Herianto Heriantolb/ft-sec μ water = 1,0 x 87,9 Cst = 87,9 cp = 87,9/1488 = 0,05907 lb/ft-sec μ mixed = 0,8931x 87,9 Cst = 78,5077 cp = 0,05276 lb/ft-sec c. Velocity can be calculated by Equ. (6): V= = Q( BFPD ) x 42( gal / bbl )

(4) Widely Conserved Signaling Pathways in the Establishment of Cell PolarityCold Spring Harbor Perspectives in BiologyJanuary 13, 2010Luke Martin McCaffrey, I. G. MacaraCenter for Cell Signaling, University of Virginia School of Medicine, Charlottesville, Virginia 22908-5077 Correspondence: igm9c@virginia.edu How are the asymmetric distributions of proteins, lipids, and RNAs

Be the First to Write a Review!

SimpleChIP ® Human Sat2 Repeat Element Primers from Cell Signaling Technology

Cell Signaling Technology

Citations (4)

Reviews

SimpleChIP ® Human Sat2 Repeat Element Primers from Cell Signaling Technology

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map