pGFP-A-shAAV shRNA Vector from OriGene Technologies

Product Specs
ItempGFP-A-shAAV shRNA Vector
CompanyOriGene Technologies
Price $880.00Supplier Page View Company Product Page
Catalog NumberTR30034
TypeshRNA Vectors
Quantity5 µg
Selectable MarkerAmpicillin
ResistancePuromycin

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) Male rat hypothalamic extraretinal photoreceptor Opsin3 is sensitive to osmotic stimuli and lightJournal of NeuroendocrinologyFebruary 1, 2024Soledad Bárez‐López, Paul Bishop, Daniel Searby, David Murphy, Michael P. Greenwood(AATTCTCCGAACGTGTCACGT), 23 used as a control, were cloned into HuSH shRNA GFP AAV Cloning Vector (pGFP‐A‐shAAV Vector; TR30034, Origene). The efficiency of the specific Opn3 shRNA was tested in HEK293T/17 cells (human embryonic

(2) Transcription factor Creb3l1 maintains proteostasis in neuroendocrine cellsMolecular MetabolismSeptember 1, 2022Mingkwan Greenwood, Benjamin T. Gillard, Rizwan Farrukh, Alex Paterson, Ferdinand Althammer, Valery Grinevich, David Murphy, Michael P. Greenwoodvalidation Creb3l1 and non-targeting short hairpin RNAs (shRNAs) were cloned into pGFP-A-shAAV (OriGene, TR30034) as previously described [20]. We generated adeno-associated viruses (AAVs) expressing GFP and Creb3l1CA

(3) Dyrk1b promotes hepatic lipogenesis by bypassing canonical insulin signaling and directly activating mTORC2 in miceThe Journal of clinical investigationFebruary 1, 2022Bhat N, Narayanan A, Fathzadeh M, Kahn M, Zhang D, Goedeke L, Neogi A, Cardone RL, Kibbey RG, Fernandez-Hernando C, et al.TL514285) and shuttled into the AAV vector with U6 promoter and inverse terminal repeats (Origene Inc., TR30034). The sequences of the Dyrk1b shRNAs and scrambled shRNA are reported in Supplemental Table 2. The viruses

(4) Rapid 3D Enhanced Resolution Microscopy Reveals Diversity in Dendritic Spinule Dynamics, Regulation, and FunctionNeuronAugust 5, 2020Zaccard CR, Shapiro L, Martin-de-Saavedra MD, Pratt C, Myczek K, Song A, Forrest MP, Penzes P.Mayfield,Addgene plasmid # 64904;http://addgene.org/64904; RRID:Addgene_64904 pGFP-A-shAAV,Origene,Cat#TR30034 pLV-Kal-7 mCherry [NM_001164268.1],VectorBuilder,VB181102-1224vxt pLV-mCherry,VectorBuilder,VB181030-1317wkh Software

(5) Transcription factor Creb3l1 regulates the synthesis of prohormone convertase enzyme PC1/3 in endocrine cellsJournal of neuroendocrinologyApril 1, 2020Greenwood M, Paterson A, Rahman PA, Gillard BT, Langley S, Iwasaki Y, Murphy D, Greenwood MP.

Be the First to Write a Review!