pRFP-CB-shLenti shRNA Vector from OriGene Technologies

Product Specs
ItempRFP-CB-shLenti shRNA Vector
CompanyOriGene Technologies
Price $880.00Supplier Page View Company Product Page
Catalog NumberTR30032
TypeshRNA Vectors
Quantity5 µg
Selectable MarkerChloramphenicol
ResistanceBlasticidin

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) A Cdh3-β-catenin-laminin signaling axis in a subset of breast tumor leader cells control leader cell polarization and directional collective migrationDevelopmental cellJanuary 9, 2023Hwang PY, Mathur J, Cao Y, Almeida J, Ye J, Morikis V, Cornish D, Clarke M, Stewart SA, Pathak A, et al.TL500332 pGFP-C-shLenti-scramble (human),Origene,Cat# TR30021 pRFP-C-shLenti-scramble (mouse),Origene,Cat# TR30032 pLKO.1-puro-laminina3 (mouse),Sigma Aldrich,Cat# XM_140451 pLKO.1-puro-scramble (mouse),Sigma Aldrich,Cat#

(2) Molecular motor protein KIF5C mediates structural plasticity and long-term memory by constraining local translationCell reportsJuly 13, 2021Swarnkar S, Avchalumov Y, Espadas I, Grinman E, Liu XA, Raveendra BL, Zucca A, Mediouni S, Sadhu A, Valente S, et al.Lab pGL-FLKif3A-C1,Addgene (Linda Wordeman),Addgene plasmid # 13742 pRFP-C-shLenti EIF3G,Origene,catalog# TR30032 peGFP-C-shLenti Kif5C,Origene,catalog# TL511686 Software and algorithms,Software and algorithms,Software

(3) The ubiquitin-proteasome system functionally links neuronal Tomosyn-1 to dendritic morphologyThe Journal of biological chemistryFebruary 16, 2018Saldate JJ, Shiau J, Cazares VA, Stuenkel EL.

(4) Chronic Cigarette Smoke-Induced Epigenomic Changes Precede Sensitization of Bronchial Epithelial Cells to Single-Step Transformation by KRAS MutationsCancer CellSeptember 1, 2017Michelle Vaz et al.shRNA sequence for TP-53 (ACGGCGCACAGAGGAAGAGAAT) was cloned in the pRFP-CB-shLenti Lentiviral vector (TR30032) by OriGene. This sequence was obtained from SIGMA mission shRNA sequences shown to have on efficiency

(5) Dendrosomatic Sonic Hedgehog Signaling in Hippocampal Neurons Regulates Axon ElongationThe Journal of neuroscience : the official journal of the Society for NeuroscienceDecember 9, 2015Yao PJ, Petralia RS, Ott C, Wang YX, Lippincott-Schwartz J, Mattson MP.

Be the First to Write a Review!