pGFP-C-shLenti shRNA Vector from OriGene Technologies

Product Specs
ItempGFP-C-shLenti shRNA Vector
CompanyOriGene Technologies
Price $880.00Supplier Page View Company Product Page
Catalog NumberTR30023
TypeshRNA Vectors
Quantity5 µg
Selectable MarkerChloramphenicol
ResistancePuromycin

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) The cytoskeletal regulator Coronin-1A plays a multidirectional role in glioblastoma stemnessScientific ReportsMay 28, 2026TingTing Zhang, Ichiyo Shibahara, Takuichiro Hide, Toshihiro Kumabe, Shun-Ichiro Ogura, Tetsuya Taga, Kouichi Tabuencoding shRNA against human Coro1A was purchased from Origene Technologies (Rockville, MD, USA; Cat. No. TR30023). The effective shRNA sequences were: #A, 5′-GACACCAACATCGTCTACCTCTGTGGCAA-3′; and #B, 5′-AAGTCGGACCTGTTCCAGGAGGACCTGTA-3′.

(2) APOs as promising prognostic biomarkers: correlation with tumor-infiltrating leukocytes in endometrial cancerFrontiers in ImmunologyFebruary 16, 2026Lina Zhou, Rencheng Wang, Guiqiang Du, Yupeng Wu, Hui Li, Yinyan He, Zhikang Ye, Jiangdong XiangRockville, MD, USA) and APOE (si-APOE; TR314721; OriGene), and the corresponding control (negative control; TR30023; OriGene) were transfected with reagents (TF81001; OriGene) for 12 h. The culture was then continued

(3) Targeting the STK39/ARID2 Axis to Inhibit NF-κB Signaling: A Novel Pathway for Mesenchymal Stem Cell Osteogenic Differentiation in Osteoporosis ManagementJ Musculoskelet Neuronal InteractJanuary 1, 2026Yang Wang, Dong Wei, Zhineng Chen, Liang Zhongand STK39 overexpression (RC223981L4V), together with their corresponding negative controls (siNC; TR30023 and NC; PS100093), were obtained from OriGene (Rockville, MD, USA). BMSCs were allocated to the following

(4) Targeting the STK39/ARID2 Axis to Inhibit NF-κB Signaling: A Novel Pathway for Mesenchymal Stem Cell Osteogenic Differentiation in Osteoporosis ManagementJ Musculoskelet Neuronal InteractJanuary 1, 2026Yang Wang, Dong Wei, Zhineng Chen, Liang Zhongand STK39 overexpression (RC223981L4V), together with their corresponding negative controls (siNC; TR30023 and NC; PS100093), were obtained from OriGene (Rockville, MD, USA). BMSCs were allocated to the following

(5) Selenoprotein O Promotes Melanoma Metastasis and Regulates Mitochondrial Complex II ActivityCancer ResearchMarch 3, 2025Luiza Martins. Nascentes Melo, Marie Sabatier, Vijayashree Ramesh, Krystina J. Szylo, Cameron S. Fraser, Alexandra Pon, Evann C. Mitchell, Kelly A. Servage, Gabriele Allies, Isa V. Westedt, et al.above. All short hairpin RNAs (shRNA) were expressed from a pGFP-C-shLenti shRNA vector (OriGene, cat. #TR30023) to infect melanoma cells. For knockdown of SELO, OriGene shRNA clones from the package TR510509 were

(6) Selenoprotein O Promotes Melanoma Metastasis and Regulates Mitochondrial Complex II ActivityCancer ResDecember 19, 2024Luiza Martins Nascentes Melo, Marie Sabatier, Vijayashree Ramesh, Krystina J. Szylo, Cameron S. Fraser, Alex Pon, Evann C. Mitchell, Kelly A. Servage, Gabriele Allies, Isa V. Westedt, et al.above. All short hairpin RNAs (shRNA) were expressed from a pGFP-C-shLenti shRNA vector (OriGene, cat. #TR30023) to infect melanoma cells. For knockdown of SELO, OriGene shRNA clones from the package TR510509 were

(7) Lipolysis-Stimulated Lipoprotein Receptor in Proximal Tubule, BMP-SMAD Signaling, and Kidney DiseaseJournal of the American Society of NephrologyAugust 1, 2024Min Jiang, Xiangdong Wang, Zhenni Chen, Xin Wang, Yanan An, Lixia Ding, Mengyuan Xu, Baozhen Fan, Peng Jiao, Chao Wang, et al.(mouse Elavl1 shRNA plasmid, TL501023), and pGFP-C-shLenti shRNA Vector (shRNA GFP Lenti cloning vector, TR30023) were obtained from Origene, US. Lsr truncation, S356A, S417A, S454A, and S494A mutants were generated

(8) Involvement of Kindlin-1 in cutaneous squamous cell carcinomaOncogenesisJuly 9, 2024Giovana Carrasco, Ifigeneia Stavrou, Mairi Treanor-Taylor, Henry Beetham, Martin Lee, Roza Masalmeh, Artur Carreras-Soldevila, David Hardman, Miguel O. Bernabeu, Alex von Kriegsheim, et al.Kingdom). Knockdown of MMP13 was achieved with the use of shRNA constructs in vector pGFP-C-shLenti (TR30023) from OriGene Technologies (Rockville, MD, USA) and is described in the Supplementary material. MMP13

(9) Frataxin deficiency shifts metabolism to promote reactive microglia via glucose catabolismLife Science AllianceJuly 1, 2024Francesca Sciarretta, Fabio Zaccaria, Andrea Ninni, Veronica Ceci, Riccardo Turchi, Savina Apolloni, Martina Milani, Ilaria Della Valle, Marta Tiberi, Valerio Chiurchiù, et al.Fxn mouse shRNA lentiviral particle (Locus ID 14297) was generated using the pGFP-C-shLenti vector (TR30023). To facilitate viral particle entry in the cells 2 μg/ml polybrene (Sigma-Aldrich), we added to the

(10) Lipolysis-Stimulated Lipoprotein Receptor in Proximal Tubule, BMP-SMAD Signaling, and Kidney DiseaseJ Am Soc NephrolMay 29, 2024Min Jiang, Xiangdong Wang, Zhenni Chen, Xin Wang, Yanan An, Lixia Ding, Mengyuan Xu, Baozhen Fan, Peng Jiao, Chao Wang, et al.(mouse Elavl1 shRNA plasmid, TL501023), and pGFP-C-shLenti shRNA Vector (shRNA GFP Lenti cloning vector, TR30023) were obtained from Origene, US. Lsr truncation, S356A, S417A, S454A, and S494A mutants were generated

(11) Tubulointerstitial nephritis antigen-like 1 from cancer-associated fibroblasts contribute to the progression of diffuse-type gastric cancers through the interaction with integrin β1Journal of translational medicineFebruary 14, 2024Lee D, Ham IH, Oh HJ, Lee DM, Yoon JH, Son SY, Kim TM, Kim JY, Han SU, Hur H.pGFP-C-shLenti plasmid containing anti-TINAGL1 (TL307228, Origene) or scrambled negative control sequences (TR30023, OriGene) were used to generate stable cell lines. Immortalized CAFs were infected with lentivirus,

(12) p53 Gain-of-Function Mutation Induces Metastasis via BRD4-Dependent CSF-1 ExpressionCancer discoveryDecember 12, 2023Efe G, Dunbar KJ, Sugiura K, Cunningham K, Carcamo S, Karaiskos S, Tang Q, Cruz-Acuña R, Resnick-Silverman L, Peura J, et al.transduced with pGFP-C-shLenti lentiviral particles with non-target, shBrd4 A, and shBrd4 B (Origene, TR30023; Supplementary Table S1). After 48 hours, stable colonies were selected using 2μg/mL Puromycin (Sigma

(13) A Cdh3-β-catenin-laminin signaling axis in a subset of breast tumor leader cells control leader cell polarization and directional collective migrationDevelopmental cellJanuary 9, 2023Hwang PY, Mathur J, Cao Y, Almeida J, Ye J, Morikis V, Cornish D, Clarke M, Stewart SA, Pathak A, et al.we synthesized 5 different shRNA lentivirus particles – both human and mouse specific Cdh3 (Origene, TR30023 (human), TL500332 (mouse)) and Laminin α3 (Sigma-Aldrich), as well as corresponding scramble (shSCR)

(14) Role of circular RNA cdr1as in modulation of macrophage phenotypeLife sciencesNovember 15, 2022Gonzalez C, Cimini M, Cheng Z, Benedict C, Wang C, Trungcao M, Mallaredy V, Rajan S, Garikipati VNS, Kishore R.was performed using the combined ratio of transfer plasmid (Custom shRNA plasmid from Origene, Inc. TR30023 Lenti GFP-C-sh-9B, TTCCAACAACTGCGCAGTGTCTCCAGTGT), packaging plasmid, Env plasmid and pRSV-Rev plasmid

(15) Temporal profiling of therapy resistance in human medulloblastoma identifies novel targetable drivers of recurrenceScience advancesDecember 10, 2021Bakhshinyan D, Adile AA, Liu J, Gwynne WD, Suk Y, Custers S, Burns I, Singh M, McFarlane N, Subapanditha MK, et al.the control vector (shCTRL: 5′-ATCAGTTGCTCAGATACTCAGC-3′) were purchased from OriGene (#TL305949 and #TR30023). OE BPIFB4 constructs were purchased from GeneCopoeia (EX-Y2680-LV122). Lentiviral pLKO.1 vectors expressing

(16) lncRNA ST8SIA6‑AS1 facilitates proliferation and invasion in liver cancer by regulating miR‑142‑3pExperimental and Therapeutic MedicineSeptember 23, 2021Yang Zhang, Yan Yang, Yi Zhang, Zhisu Liuwere subcloned into the green fluorescence protein (GFP)-expressing pGFP-C-shLenti vector (cat. no. TR30023; OriGene Technologies) according to the manufacturer's instructions. First, 293T cells (ATCC) were seeded

(17) Loss of SNORA73 reprograms cellular metabolism and protects against steatohepatitisNature communicationsSeptember 1, 2021Sletten AC, Davidson JW, Yagabasan B, Moores S, Schwaiger-Haber M, Fujiwara H, Gale S, Jiang X, Sidhu R, Gelman SJ, et al.SNORA73 and the SNHG3 lncRNA, or GFP as a control. pGFP-C-shLENTI lentiviral shRNA constructs (Origene TR30023) were designed to target hamster SNHG3 lncRNA or GFP as a control. See Supplementary Table 2. For LNA

(18) FGF23 ameliorates ischemia-reperfusion induced acute kidney injury via modulation of endothelial progenitor cells: targeting SDF-1/CXCR4 signalingCell death & diseaseApril 17, 2021Chang HM, Peng KY, Chan CK, Sun CY, Chen YY, Chang HM, Huang CL, Liu PC, Chen PY, Wang KC, et al.vectors containing shRNA targeting human Klotho (TL303679A) or non-targeting scrambled shRNA cassette (TR30023) were purchased from Origene. For the RelA knockdown assay, SignalSilence NF-κB p65 siRNA II (#6534)

(19) O-GlcNAcylation Enhances NUSAP1 Stability and Promotes Bladder Cancer AggressivenessOncoTargets and therapyJanuary 1, 2021Chen Y, Liu J, Zhang W, Kadier A, Wang R, Zhang H, Yao X.plasmid of NUSAP1 (OE-NUSAP1) was synthesized by GenePharma (Suzhou, Jiangsu, China). The shRNAs (No.TR30023) targeting human OGT gene and their controls were purchased from Origene (CA, USA). Lipofectamine 2000

(20) Ribosome Collisions Trigger General Stress Responses to Regulate Cell FateCellJuly 23, 2020Wu CC, Peterson A, Zinshteyn B, Regot S, Green R.

Be the First to Write a Review!