AAV-EF1a-BbChT (AAV9) from Addgene Inc.

Product Specs
ItemAAV-EF1a-BbChT (AAV9)
CompanyAddgene Inc.
Price Supplier Page View Company Product Page
Catalog Number45186-AAV9
Quantity100 µL
Puritysuitable purity for injection into animals
Speciesrecombinant adeno-associated virus (rAAV)
Molecule NamepAAV-Ef1a-Brainbow/mCherry/mTFP-WPRE
Source/Expression SystemMammalian
Nucleic Acid TypeExpression Vectors
Expression System (standardized)Mammalian
Vector Type (Standardized)AAV
PromoterEF1a

Add to Compare List

Addgene Inc.

490 Arsenal Way

Suite 100

Watertown, Massachusetts 02472

United States

Phone: +1 (617) 233-4363

Email: help@addgene.org

Company Profile

Website: www.addgene.org/

(1) Population-level geometric filtering generates motion-coherence selectivity in the retinaSci AdvAugust 21, 2026Pratyush Ramakrishna, Andrew Jo, Liam McCoy, Josh L. Morgan, Daniel Kerschensteinerand injected intraocularly with 350 nl of a 1:1 mixture of AAV-EF1a-BbChT (AAV9; Addgene viral prep #45186-AAV9) and AAV-EF1a-BbTagBY (AAV9; Addgene viral prep #45185-AAV9). These vectors encode Brainbow fluorophores

(2) Temporally segregated functions for Gfi1 in the development and maintenance of direction selectivity in the vertebrate retinaCurrent biology : CBAugust 3, 2026Chaudhari K, Guzman-Clavel LE, Donthi N, Yang J, Harris SC, Lin TH, Dunn FA, Kolodkin AL.were co-injected. The following viruses were used in this study: AAV9 EF1a-BbChT (>1E+13; Addgene #45186-AAV9) and AAV2 CAG-mWGA-mCherry (2E+12; Virovek, Inc. Cat # 117BUCSF89). Stereotactic surgery and MTN injections P4

(3) The mechanotransduction channel Piezo2 refines axonal projections to the accessory optic system and regulates the optokinetic reflexbioRxivJuly 5, 2026Natalie R. Hamilton, Victoria N. Neckles, Timour Al-Khindi, Nitya Donthi, Shun Mizutori, Renata Fu, James K. Kiraly, Bea C. Winship, Alex L. Kolodkin, Karina Chaudharivitreous using a pulled glass pipette. The following reagents were used: AAV9-BbChT (Addgene, stock #45186-AAV9), AAV2 CAG-FLEX-GFP (UNC Vector Core), cholera toxin subunit B Alexa Fluor 555 conjugate (1 mg/mL, ThermoFisher

(4) Reduced Neuronal Self-Avoidance in Mouse Starburst Amacrine Cells With Only One Pcdhg IsoformDev NeurobiolDecember 29, 2025Cathy M. McLeod, Seoyoung Son, Muhammad Nazmul Haque, Camille M. Hanes, Andrew M. GarrettViral Vectors Brainbow viral particles were purchased from Addgene (Catalog numbers 45185‐AAV9 and 45186‐AAV9). For Brainbow with shRNA knockdown of Pcdha, we used the following targeting sequence: AACAGTATCCAGTGCAACACC

(5) Temporally-segregated dual functions for Gfi1 in the development of retinal direction-selectivitybioRxivJune 6, 2025Karina Chaudhari, Luis E. Guzman-Clavel, Alex L. Kolodkinwere co-injected. The following viruses were used in this study: AAV9 EF1a-BbChT (>1E+13; Addgene #45186-AAV9) and AAV2 CAG-mWGA-mCherry (2E+12; Virovek, Inc. Cat # 117BUCSF89). Stereotactic surgery and MTN injections P4

(6) Reduced neuronal self-avoidance in mouse starburst amacrine cells with only one Pcdhg isoformbioRxivJune 1, 2025Cathy M. McLeod, Seoyoung Son, Muhammad Nazmul Haque, Andrew M. Garrett548661). Viral vectors: Brainbow viral particles were purchased from Addgene (Catalog numbers 45185-AAV9 and 45186-AAV9). For Brainbow with shRNA knockdown of Pcdha, we used the following targeting sequence: AACAGTATCCAGTGCAACACC.

(7) An experimental platform for stochastic analyses of single serotonergic fibers in the mouse brainFrontiers in NeuroscienceOctober 6, 2023Kasie C. Mays, Justin H. Haiman, Skirmantas Janušonisadeno-associated viruses (AAVs) (AAV-EF1a-BbTagBY [Addgene #45185-AAV9] and AAV-EF1a-BbChT [Addgene #45186-AAV9]) (Cai et al., 2013) were stored at −75°C. Before use, they were diluted to 1.5 × 1012 vg/mL each in

(8) Morphological pseudotime ordering and fate mapping reveal diversification of cerebellar inhibitory interneuronsNature communicationsJune 14, 2022Wang WX, Lefebvre JL.Sanes and obtained from the University of Pennsylvania Vector Core (Addgene viral preps # 45185-AAV9; # 45186-AAV9). In total, ~1 × 1012 viral genome particles per mL of each vector was prepared in sterile phosphate-buffered

(9) Mouse Retinal Cell Atlas: Molecular Identification of over Sixty Amacrine Cell TypesThe Journal of neuroscience : the official journal of the Society for NeuroscienceJuly 1, 2020Yan W, Laboulaye MA, Tran NM, Whitney IE, Benhar I, Sanes JR.AAV9-EF1a-BbTagBY (Cai et al., 2013; catalog #45185-AAV9, Addgene), AAV9-EF1a-BbChT (Cai et al., 2013; catalog #45186-AAV9, Addgene), or AAV9-CAG-tdTomato (catalog #51503-AAV9, Addgene). Intravitreal injections were performed

(10) AMIGO2 Scales Dendrite Arbors in the RetinaCell reportsNovember 5, 2019Soto F, Tien NW, Goel A, Zhao L, Ruzycki PA, Kerschensteiner D.Strains,, ,, AAV-EF1a-BbTagBY (AAV-Brainbow),Addgene,Cat# 45185-AAV9 AAV-EF1a-BbChT (AAV-Brainbow),Addgene,Cat# 45186-AAV9 AAV-Grm6-YFP,"Johnson et al., 2017",N/A AAV-CAG-YFP,"Soto et al., 2018",N/A ,, "Chemicals, Peptides,

Be the First to Write a Review!

AAV-EF1a-BbChT (AAV9) from Addgene Inc.

Description

Addgene Inc.

Citations (10)

Reviews

AAV-EF1a-BbChT (AAV9) from Addgene Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map