BseYI from New England Biolabs

Product Specs
ItemBseYI
CompanyNew England Biolabs
Price $75.00 Inquire
Catalog NumberR0635S
Concentration5,000 units/ml
Quantity100 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

C/CCAGC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) doc2a and doc2b contribute to locomotor and social behaviors by down-regulating npas4b in zebrafishBMC BiologyJuly 1, 2025Yali Chi, Tao Feng, Zixin Du, Ping Huang, Wenjun Yu, Haihua Liu, Wanshan Wang, Xinping Yang, Liping Huanginjected embryos and subjected to PCR and digestion for genotyping. MscI (R0534, NEB, USA) and BseYI (R0635, NEB, USA) were used to digest the PCR products from doc2a and doc2b, respectively. T7 Endonuclease I

(2) Protocol for profiling RNA m5C methylation at base resolution using m5C-TAC-seqSTAR ProtocolsMarch 1, 2025Xiaoting Zhang, Liang Lu, Chengqi Yi, Xiaoyu LiNEBNext Magnesium RNA Fragmentation Module,NEB,Cat#E6150S T4 polynucleotide kinase,Vazyme,Cat#N102-01 "T4 RNA ligase 2, truncated",Beyotime,Cat#R0635L "T4 RNA ligase 1, high concentration",NEB,Cat#M0437M 5′ Deadenylase,NEB,Cat#M0331S RecJf,NEB,Cat#M0264S Proteinase

(3) Eliminating malaria vectors with precision-guided sterile malesProceedings of the National Academy of SciencesJuly 2, 2024Reema A. Apte, Andrea L. Smidler, James J. Pai, Martha L. Chow, Sanle Chen, Agastya Mondal, Héctor M. Sánchez C., Igor Antoshechkin, John M. Marshall, Omar S. Akbariand 1154A.S8 (5′ GTTGAACGCTTCGTCGTACG 3′) primers, and the amplicon was digested with BseYI (NEB cat# R0635S). All PCRs were performed using Q5 HotStart DNA polymerase (NEB, Cat. No./ID: M0493L). Digestions were

(4) Eliminating Malaria Vectors with Precision Guided Sterile MalesbioRxivJuly 26, 2023Andrea L. Smidler, Reema A. Apte, James J. Pai, Martha L. Chow, Sanle Chen, Agastya Mondal, Héctor M. Sánchez C., Igor Antoshechkin, John M. Marshall, Omar S. Akbariand 1154A.S8 (5’ GTTGAACGCTTCGTCGTACG 3’) primers, and the amplicon was digested with BseYI (NEB cat# R0635S). All PCR reactions were performed using Q5 HotStart DNA polymerase (NEB, Cat. No./ID: M0493L). Digestions

(5) A confinable female-lethal population suppression system in the malaria vector, Anopheles gambiaeScience AdvancesJuly 7, 2023Andrea L. Smidler, James J. Pai, Reema A. Apte, Héctor M. Sánchez C., Rodrigo M. Corder, Eileen Jeffrey Gutiérrez, Neha Thakre, Igor Antoshechkin, John M. Marshall, Omar S. Akbariwas digested with BstNI (catalog no./ID: R0168S), and one was undigested with BseYI (NEB, catalog no. R0635S) according to the manufacturer’s protocols. PCR amplicons from WT alleles are expected to digest into

(6) Interaction of cry1 gene polymorphisms and dominant food patterns on obesity: A cross-sectional studyInternational Journal of Preventive MedicineApril 5, 2022Khadijeh Tangestani, Hadith Tangestani, Mir Saeed Yekaninejad, MirSaeed Yekaninejad, Seyed Ali Keshavarz, SeyedAli Keshavarzwere done for 35 cycles. PCR products were digested using BseYI (New England Biolabs, Cataloge number: R0635S) which yielded two cuts and three fragments of 108, 50, and 226 base pairs (bps); and one cut and two

(7) Variants in Circadian Rhythm Gene Cry1 Interacts with Healthy Dietary Pattern for Serum Leptin Levels: a Cross-sectional StudyClinical Nutrition ResearchJanuary 28, 2021Hadith Tangestani, Hadi Emamat, Mir Saeed Yekaninejad, Seyed Ali Keshavarz, Khadijeh Mirzaeiand the rest of the steps were done once. PCR products were digested using BseYI (cataloge number: R0635S; New England Biolabs, Essex, MA, USA) which yielded 2 cuts and 3 fragments of 108, 50, and 226 base

(8) Altered 3D chromatin structure permits inversional recombination at the IgH locusScience advancesAugust 1, 2020Qiu X, Ma F, Zhao M, Cao Y, Shipp L, Liu A, Dutta A, Singh A, Braikia FZ, De S, et al.generation as described (39). Restriction enzyme Sac 1–HF [R3156S, New England Biolabs (NEB)] and Bse YI (R0635S, NEB) were used to digest germline DNA with DQ52 and DSP2 as bait, respectively. Paired-end reads (2

(9) Matrilin-3 gene polymorphism in primary knee osteoarthritis: An Evidence based systematic reviewAsian Journal of Medical SciencesJuly 1, 2020Arun Kumar Sharma, Rajbeer Singh, Devendra Singh, Anurag Shukla, Ramesh C Meena, Divyanshu Goyal, Priyanka Sharma, Uday Ramansingle fragment at 501 bp. 10 μL of 501-bp product were then digested with restriction enzyme (NEB-R0635S) at 37°C for 10 h. Digestion products were visualized on a 3% agarose gel containing ethidium bromide.

(10) MATN3 Gene Polymorphism Is Associated with Osteoarthritis in Chinese Han Population: A Community-Based Case-Control StudyThe Scientific World JournalAugust 22, 2012Jiaao Gu, Jiesheng Rong, Fulin Guan, Liying Jiang, Shuqing Tao, Guofa Guan, Tianzun Taofragment at 501 bp. 10 μL of 501-bp product were then digested with 10 units of BSEYI restriction enzyme (NEB-R0635S) at 37◦ C for 10 h. Digestion products were visualized on a 3% agarose gel containing ethidium bromide.

Be the First to Write a Review!

BseYI

BseYI from New England Biolabs

Description

Sequence

New England Biolabs

Citations (10)

Reviews

BseYI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map