XcmI from New England Biolabs

Product Specs
ItemXcmI
CompanyNew England Biolabs
Price $75.00 Inquire
Catalog NumberR0533S
Quantity1000 units
ApplicationsDNA Manipulation
Concentration10 u/µL
TypeRestriction Enzyme
Temperature-20 C

Sequence

CCAN5/N4TGG

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Sulfatase modifying factors control the timing of zebrafish convergence and extension morphogenesisNature CommunicationsMarch 31, 2026Ailen Soledad Cervino, Amrita Basu, Ryan J. Weiss, Gursimran Kaur Bajwa, Rubén Marín-Juez, Sandra L. Grimm, Cristian Coarfa, Margot Kossmann Williamsrestriction site, enabling genotyping by digestion of the PCR-amplified target fragment with XcmI (NEB, R0533S) (Supplementary Fig. 3B). Heterozygous F1 carriers were incrossed to produce the F2 generation. Homozygotes

(2) In vivo screen reveals specific roles of Hippo pathway components in development and regenerationLife Sci AllianceDecember 29, 2025Susanna E Riley, Michaela Noskova Fairley, Shijia Xia, Richard Cunningham, Justyna Cholewa-Waclaw, Yi Feng, Carsten Gram HansenSigma-Aldrich UltraPure Distilled Water DNase/RNase Free,10977-049; Invitrogen XcmI with NEB buffer 2.1,R0533S; NEB X-gal,16495; Cambridge BioScience X-ray films,MOL7016; Scientific Laboratory Supplies Yap1 1°

(3) Development of pXeDNA3.1-LacZ, a Dual-System Plasmid for Membrane Protein Expression in Xenopus and Mammalian CellsMicroPubl BiolDecember 1, 2025Li Guan, Tom E. Reynoldson, Eleonora M. Pieroni, James C. Dillon, Iris Hardege, Luis A. Yanez-Guerrarequired for subsequent TA cloning. The pXeDNA3.1-LacZ vector was linearised using XcmI (NEB, Cat. No. R0533), generating complementary thymine (T) overhangs. Digestion was confirmed by agarose gel electrophoresis.

(4) Sulfatase modifying factors control the timing of zebrafish convergence and extension morphogenesisbioRxivNovember 14, 2025Ailen Soledad Cervino, Amrita Basu, Ryan J. Weiss, Gursimran Kaur Kaur Bajwa, Rubén Marín Marín Juez, Sandra Grimm, Cristian Coarfa, Margot Kossmann Williamsrestriction site, enabling genotyping by digestion of the PCR-amplified target fragment with XcmI (NEB, R0533S) (Supplementary Fig. 2B). Heterozygous F1 carriers were incrossed to produce the F2 generation. Homozygotes

(5) Genome-Wide Identification and Functional Characterization of CesA10 and CesA11 Genes Involved in Cellulose Biosynthesis in SugarcaneInternational Journal of Molecular SciencesNovember 14, 2025Yi Xu, Nameng Qi, Yi Han, Liying Cai, Xue Wang, Heyang Shang, Qing Zhang, Jisen Zhangselected, and the positive plasmids were recovered. Double digestion was performed using Xcm I (NEB#: R0533S) restriction enzyme. Rice genetic transformation was performed by Wuhan Boyuan Biotechnology Co., Ltd.

(6) Oxytocin receptors mediate social selectivity in prairie vole peer relationshipsCurrent BiologySeptember 8, 2025Alexis M. Black, Natsumi Komatsu, Jiaxuan Zhao, Scarlet R. Taskey, Nicole S. Serrano, Ruchira Sharma, Devanand S. Manoli, Markita P. Landry, Annaliese K. Beery"Proteinase K, recombinant PCR grade",Roche Diagnostic,03115879001 XcmI restriction enzyme,New England Biolabs,NEB# R0533S Critical commercial assays,Critical commercial assays,Critical commercial assays Qiagen DNEasy kit,Qiagen,Cat#

(7) Protocol to modulate SUMOylation of a specific protein in budding yeast using chemical genetic approachesSTAR ProtocMarch 21, 2025Emily Gutierrez-Morton, Yanchang Wang,New England Biolabs,R0101S EcoRV,New England Biolabs,B6004S XcmI,New England Biolabs,R0101S 10× rCutSmart buffer,New England Biolabs,R0533S Sodium hydroxide,Fisher Scientific,S318-500 Agar,Difco,214010 Glucose,Alfa Aesar,A16828 Yeast extract,Fisher

(8) Cell Type Specific Suppression of Hyper-Recombination by Human RAD18 Is Linked to Proliferating Cell Nuclear Antigen K164 UbiquitinationBiomoleculesJanuary 20, 2025Colette B. Rogers, Wendy Leung, Ryan M. Baxley, Rachel E. Kram, Liangjun Wang, Joseph P. Buytendorp, Khoi Le, David A. Largaespada, Eric A. Hendrickson, Anja-Katrin BielinskyEcoRI, NEB, Ipswich, MA, USA; R3101; restriction enzyme for PCNAex5_gRNA_2: XcmI, NEB, Ipswich, MA, USA; R0533). Mutations were validated by Sanger sequencing (PCNAex5_Seq: AGGTGTTGCCTTTTAAGAAAGTGAGG). To generate

(9) The TRIM37 variant rs57141087 contributes to triple-negative breast cancer outcomes in Black womenEMBO ReportsNovember 29, 2024Rachisan Djiake Tihagam, Song Lou, Yuanji Zhao, Kammi Song-Yan Liu, Arjun Tushir Singh, Bon Il Koo, Piotr Przanowski, Jie Li, Xiaosong Huang, Hong Li, et al.R3131 BAMHI,New England Biolabs,Cat# R0136S ApaI,New England Biolabs,Cat# R0114S XcmI,New England Biolabs,Cat# R0533S "Rodent Diet (2018, 625 Doxycycline)",ENVIGO,Cat# TD.01306 T4 DNA ligase,Thermo Scientific,Cat# EL0011 Q5 Site-Directed Mutagenesis Kit

(10) Large-scale analysis of the integration of enhancer-enhancer signals by promotersElifeOctober 28, 2024Miguel Martinez-Ara, Federico Comoglio, Bas van SteenselLinear barcoded vectors were purified by magnetic beads and digested for 3 hr with 40 units of XcmI (#R0533S; NEB). Finally barcoded vectors were purified again by gel-purification. Single enhancers were amplified

(11) Systematic analysis of intrinsic enhancer-promoter compatibility in the mouse genomeMolecular CellJuly 7, 2022Miguel Martinez-Ara, Federico Comoglio, Joris van Arensbergen, Bas van Steenselheat-inactivation at 80 °C. The ligations were purified by magnetic beads and digested with 40 units of XcmI (#R0533S; NEB) for 3 h, and size-selected by gel-purification. Then singlet and duplet pools were separately

(12) Repeated strand invasion and extensive branch migration are hallmarks of meiotic recombinationMolecular CellOctober 1, 2021Jasvinder S. Ahuja, Catherine S. Harvey, David L. Wheeler, Michael LichtenBiomedicals,08320932 XmnI,New England Biolabs,R0194L SpeI-HF,New England Biolabs,R3133L XcmI,New England Biolabs,R0533L HaeIII,New England Biolabs,R0108L NdeI,New England Biolabs,R0111S DdeI,New England Biolabs,R0175S PstI,New England Biolabs

(13) Bi-allelic MCM10 variants associated with immune dysfunction and cardiomyopathy cause telomere shorteningNature communicationsMarch 12, 2021Baxley RM, Leung W, Schmit MM, Matson JP, Yin L, Oram MK, Wang L, Taylor J, Hedberg J, Rogers CB, et al.restriction enzyme digestion (MCM10 exon 3, Hpy199III (NEB R0622); CDC45 exon 3, PflMI (NEB R0509), XcmI (NEB R0533) or AlwNI (NEB R0514); MCM4 exon 2, BglI (NEB R0143). To generate HCT116 MUS81-/- exon 2 mutant cell

(14) An experimental genetically attenuated live vaccine to prevent transmission of Toxoplasma gondii by catsScientific ReportsDecember 1, 2019Chandra Ramakrishnan et al.

(15) Genome-wide mapping of autonomous promoter activity in human cellsNature BiotechnologyFebruary 1, 2017Joris van Arensbergen, Vincent D. FitzPatrick, Marcel de Haas, Ludo Pagie, Jasper Sluimer, Harmen J. Bussemaker, Bas van Steenselat 80 °C. The ligation reaction was purified by magnetic beads and digested with 40 units of XcmI (#R0533S; NEB) for 3 hours, and size selected by gel-extraction, yielding 5–10 μg barcoded SuRE vector. To insert

(16) Expression of antibodies using single open reading frame (sORF) vector design: Demonstration of manufacturing feasibilitymAbsJuly 1, 2013Wendy R. Gion et al.that was prepared by BstZ17I (New England Biolabs, cat.# R0594S) and XcmI (New England Biolabs, cat.# R0533S) digestion as described above. Transformants were screened by colony PCR and sequenced for correct clones.

(17) Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arraysNature ProtocolsOctober 3, 2009Morgan L. Maeder, Stacey Thibodeau-Beganny, Jeffry D. Sander, Daniel F. Voytas, J. Keith Joungenzymes (all from New England Biolabs): BamHI (cat. no. R0136S), BbsI (cat. no R0539L), BsaI (cat. no. R0533L), EcoRI (cat. no. R0101L), HindIII (cat. no. R0104L), PstI (cat. no. R0140S), SapI (cat. no. R0569L),

Be the First to Write a Review!

XcmI

XcmI from New England Biolabs

Sequence

New England Biolabs

Citations (17)

Reviews

XcmI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map