pRL-SV40 Vector from Promega

Product Specs
ItempRL-SV40 Vector
CompanyPromega
Price $77.00Supplier Page View Company Product Page
Catalog NumberE2231
Quantity20microg
ResistanceAmpR
PromoterSV40 early enhancer/promoter
Vector NamepRL-SV40
Selectable MarkerAmpicillin
HostMammalian
ReporterRenilla luciferase
Molecular Weight~73kDa

Specifications/Features

Vector Size:
3705 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) An aerosolized dual-action autotaxin inhibitor-PPARγ agonist for the treatment of pulmonary fibrosisCell Rep MedMay 19, 2026Alexios N. Matralis, Elli-Anna Stylianaki, Eleni M. Ladopoulou, Paraskevi Kanellopoulou, Stefanos Smyrniotis, Christiana Magkrioti, Konstantinos D. Papavasileiou, Sabine Willems, Juan Pablo Rincon Pabon, Dimitris Nastos, et al.pFA-CMV-hPPARδ-LBD,Rau et al.99,N/A Plasmid: pFR-Luc,Stratagene,Cat#219050 Plasmid: pRL-SV40,Promega,Cat#E2231 ,, Software and algorithms,Software and algorithms,Software and algorithms ,, GraphPad Prism version

(2) FOXP1 is differentially active during development of murine vasopressin and oxytocin magnocellular neuronsiScienceMay 15, 2026Jari B. Berkhout, Sophie Trender, Quirin Krabichler, Yuval Podpecan, Felix Franke, Tim Schubert, Peter Burbach, Valery Grinevich, Roger Adan, Henning Fröhlich, et al.al.64,Addgene #153145 Flag-FOXP2 (pFOXP2),Moparthi et al.64,Addgene #153146 pRL-Renilla (pRL),Promega,Cat #E2231 pcDNA3.1(+),Thermo Fisher,Cat #V79020 ,, Software and algorithms,Software and algorithms,Software

(3) A microRNA expression signature in infant t(4;11) KMT2A::AFF1+ BCP-ALL uncovers novel therapeutic targetsHemasphereApril 23, 2026Camille Malouf, Alasdair Duguid, Kirsten S. Vrenken, Tom Leah, Ragini Medhi, Giuseppina Camiolo, Leslie Nitsche, Hélène Jakobczyk, Rishi S. Kotecha, Richard A. Anderson, et al.each well consisted of 98 ng of the pGL3‐promoter, 100 ng of pMIRH, and 2 ng of pRL‐SV40 (Promega Cat# E2231) in 100 µL of serum‐free DMEM and 1 mg/mL of polyethyleneimine, high molecular weight (Sigma‐Aldrich

(4) A Novel Mechanism for Depot-Specific Leptin Gene Expression Regulation and its Persistence After Weight LossiScienceApril 17, 2026Natalie Taege, Jan Hendric Britsemmer, Andreas Israel, Christin Krause, Sina Junge, Annette Feuchtinger, Siegfried Ussar, Paul Thomas Pfluger, Timo Gemoll, Sonja Charlotte Schriever, et al.US",CATGGTGTTAGGACACCGCTGTGGGAAAAACCGCTGGTCACGATGATGCCAGAA pRL-SV40 (Renilla SC40 plasmid),"Promega, US",E2231 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, CpG-free plasmid pCpGL-CMV,44,N/A Luci-RS1-CpGfree,created

(5) HSPA6 Promotes Ferroptosis in Triple-Negative Breast Cancer by Rewiring Lipid Metabolism to Potentiate Membrane Lipid PeroxidationInternational Journal of Biological SciencesApril 8, 2026Lin-Yue Hai, Zhi-Hao Yu, Wen-Bo Liu, Yuan-Yuan Zhang, Yue Xu, Shan Cheng, Hao-Ran Yue, Zhang-Yin Guo, Shi-Jie Yan, Rui Sun, et al.μg of experimental plasmid, 10 ng pRL-SV40 of Renilla luciferase internal control plasmid (Promega, E2231), and pcDNA3.1 empty vector to maintain 4 μg total DNA. After 48 h, cells were lysed in 300 μL Passive

(6) GV1001 Reprograms CD47 Immune Checkpoint to Restore Macrophage Antitumor Activity in Oral Squamous Cell CarcinomaInt J Mol SciApril 7, 2026Wei Chen, Seojin Kim, Cheyenne Beheshtian, Angela Jun, Sangjae Kim, No-Hee Park(Thermo Fisher Scientific, cat. no. 11668), together with 50 ng of the pRL-SV40 vector (Promega, cat. no. E2231, Madison, WI, USA) encoding renilla luciferase as an internal control. Cell lysates were harvested,

(7) Primary ciliogenesis is promoted during epithelial-mesenchymal transition via a miR-200 – DZIP1 axisCell Communication and SignalingApril 1, 2026Laura Sourdin, Julie M. Bracken, Katherine A. Pillman, Andrew G. Bert, Yeesim Khew Goodall, Philip A. Gregory, Gregory J. Goodall, Cameron P. Bracken(Thermo Fisher Scientific, #13778075). For luciferase assays, 20 ng pRL and 10ng pGL3basic (Promega, #212936 and #E2231) were co-transfected with miRNA mimics (Thermo Fisher Scientific, Supplementary Table 4) into 24 well

(8) ELF3 drives glioblastoma multiforme progression through the regulation of MXRA8 expressionScientific ReportsApril 1, 2026Maomao Wang, Haiji Bo, Dapeng Chen, Jiangxin Mao, Zong Miao, Laixing WangMXRA8-MT constructs (200 ng) along with a Renilla luciferase plasmid (50 ng, internal control; Promega, #E2231) using Lipofectamine 3000. To investigate the role of ELF3, cells were also co-transfected with either

(9) The human DEAD-box protein DDX3X regulates host and viral mRNA translation during Sendai Virus infectionbioRxivMarch 29, 2026Cathal S. Ryan, Dimitrios G. Anastasakis, Ahsan H. Polash, Elizabeth Sitko, Markus Hafner, Martina Schrödersimultaneously with equal amounts of pGL3–5’UTR-Firefly reporter construct and pGL3-Renilla (Promega, E2231) control, in addition to empty vector (pCMV-myc) for a total of 230 ng DNA per well, using 5% Lipofectamine

(10) Exosomal transfer of macrophage-derived NEAT1 enhances DNA damage response and confers cisplatin resistance in lung adenocarcinoma via the MAD1L1/p53 axisInt J Biol SciMarch 25, 2026Yi Yang, Min Meng, Yi Zhao, Fangyuan Yu, Harsh Patel, Zhe-Sheng Chengene plasmid was constructed using the pGL3-Basic plasmid, and Renilla luciferase plasmid pRL-SV40 (E2231, Promega) was co-transfected at 1:10 ratio for normalization. The promoter region of MAD1L1 is a 2000

(11) p53-induced RNA-binding protein ZMAT3 inhibits transcription of a hexokinase to suppress mitochondrial respiration in human cancer cellsElifeMarch 17, 2026Ravi Kumar, Simon Couly, Bruna R Muys, Xiao Ling Li, Ioannis Grammatikakis, Ragini Singh, Mary Guest, Xinyu Wen, Wei Tang, Stefan Ambs, et al.co-transfected with 250 ng of pGL4 or pGL4-HKDC1-intron 1 and 25 ng of pRL-TK (Promega, Catalog no. E2231), together with 20 nM of either AllStars Negative Control siRNA, siJUN or siZMAT3. Lipofectamine 2000 transfection reagent

(12) p53-induced RNA-binding protein ZMAT3 inhibits transcription of a hexokinase to suppress mitochondrial respiration in human cancer cellseLifeMarch 17, 2026Ravi Kumar, Simon Couly, Bruna R Muys, Xiao Ling Li, Ioannis Grammatikakis, Ragini Singh, Mary Guest, Xinyu Wen, Wei Tang, Stefan Ambs, et al.co-transfected with 250 ng of pGL4 or pGL4-HKDC1-intron 1 and 25 ng of pRL-TK (Promega, Catalog no. E2231), together with 20 nM of either AllStars Negative Control siRNA, siJUN or siZMAT3. Lipofectamine 2000 transfection reagent

(13) Endogenous retroviral elements LTR8B and MER65 rewire PSG9 regulation to control trophoblast syncytialization and pre-eclampsia riskGenome BiolMarch 9, 2026Manvendra Singh, Yuliang Qu, Amit Pande, Julianna Zadora, Florian Herse, Martin Gauster, Xuhui Kong, Rongyan Zheng, Rabia Anwar, Katarina Stevanovic, et al.104 cells/well) for 24 h were co-transfected with the internal control pRL-SV40 Vector (50 ng/well, #E2231 Promega) and candidate plasmids (250 ng/well) using the jetPRIME®transfection reagent (#114–15, Polyplus Transfection

(14) ALDH2 inhibits head and neck tumorigenesis through RAS signaling suppression, transactivation of TGM2, and synergy with ALDH6A1Cellular and Molecular Life SciencesFebruary 21, 2026Uyanahewa Gamage Shashini Janesha, Chang-Ta Chiu, Ming-Hsien Tsai, Keng-Ming Chang, Chih-Yen Chien, Hui-Shan Huang, Hao-Yi Li, Yao-Chung Yang, Hui Lu, Cheng-Tang Pan, et al.ratio of pGL4.32[luc2P/NF-κB-RE/Hygro] (700 ng) to pRL Renilla Luciferase Control Reporter Vector (E2231, Promega, control) (50 ng) was maintained at 14:1. Luminescence signals were measured using the GloMax® 20/20 Luminometer

(15) LDB1 represses fetal hemoglobin expression by enhancing BCL11A transcriptionRedox BiolFebruary 4, 2026Si-Won Park, Chang-Yong Choi, In-Byung Park, Seok-Jin Kang, Hyeon Jeong Lee, Ji-In Kim, Joonbeom Bae, Dongho Geum, Yong-Pil Cheon, Taehoon Chunvector (100 ng) containing either Bcl11a intron #3 or Bcl11a intron #4, and the pRL-SV40 vector (Promega E2231, 100 ng) containing the internal Renilla luciferase were co-transfected, along with the indicated combinations

(16) Bifidobacterium Infantis Promotes FOSL1-Mediated Transcriptional Repression of VDR to Accelerate Autoimmune Pancreatitis Progression Through Activation of Oxidative StressInflammationJanuary 23, 2026Jie Tang, Qin Li, Kai Li, Dongyun Hang, Danyin Gu, Lingmei Feng, Guoyu Chen, Ming Xuco-transfected into pDCs with the internal reference, pRL Renilla Luciferase Control Reporter Vectors (E2231, Promega) using DOTAP liposome transfection reagent. After 48 h of incubation, the pDCs were lysed,

(17) USP10 promotes glioma stem cell maintenance and glioblastoma growth by antagonizing DTX3L-mediated SATB2 ubiquitinationNature CommunicationsJanuary 8, 2026Mengyue Guo, Wenlong Luo, Peng Ling, Hong Lei, Lihua Li, Chao Duan, Zhen Xue, Min Zhang, Xiaoyan Zhang, Wendai Bao, et al.plasmid or mutant plasmid, Flag-YY2 overexpression vector, and pRL internal control vector (Promega, Cat# E2231). Luciferase activities were detected 48 hours post-transfection using the Dual-Luciferase® Reporter Assay System

(18) Splice-switching ASOs targeting the AURKA 5′ UTR collapse an SRSF1-AURKA-MYC oncogenic circuit in pancreatic cancerMolecular CellJanuary 8, 2026Alexander J. Kral, Lu Jia, GeunYoung Sim, Ledong Wan, Yuma Ishigami, Adrian R. Krainer99877 Plasmid: pCG-EV,Addgene,Cat# 51476 Plasmid: pGL4.53,Promega,Cat# E501A Plasmid: pRL-SV40,Promega,Cat# E2231 Plasmid: pCG-eGFP-AU RKA-WT,This Study,N/A Plasmid: pCG-eGFP-AURKA-D274N,This Study,N/A Plasmid:

(19) IRF4 haploinsufficiency in a multiplex family with Whipple’s diseaseJournal of Human ImmunityJanuary 5, 2026Sinem Ünal, Stéphanie Dublanc, Hailun Li, Jean-Philippe Vernhes, Vincent Meynier, Camille Soudée, Whipple’s consortium, Achille Aouba, Sylvain Audia, Nabil Bel Feki, et al.(pGL3 backbone, #102597; Addgene) (100 ng/well and 100 μl DMEM-10% FBS medium), the pRL-SV40 vector (#E2231; Promega, 40 ng/well), and IRF4 WT or IRF4 mutant pcDNA3.1D V5-His-TOPO IRF4 plasmid (0.5 ng/well),

(20) Sensory-neuron-derived CGRPα controls white adipocyte differentiation and tissue plasticityCell ReportsDecember 23, 2025Kyle D. Dumont, Saba Heydari Heydari Seradj, Yu Wang, Shanshan Liu, Igor Cervenka, Chao Wu, Paulo R. Jannig, Margareta Porsmyr-Palmertz, Gerard Baiges-Gaya, Xun Huang, et al.co-transfected with 50 ng of Calca-luci, 100 ng of sgRNA-CRISPRi plasmid, and 20 ng of pRL-Renilla (Promega, E2231) using Lipofectamine 2000 (Invitrogen, 11668027). After 24 h, luciferase activity was measured using

Be the First to Write a Review!

pRL-SV40 Vector

pRL-SV40 Vector from Promega

Description

Specifications/Features

Promega

Citations (311)

Reviews

pRL-SV40 Vector from Promega

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map