pmirGLO Dual-Luciferase miRNA Target Expression Vector from Promega

Product Specs
ItempmirGLO Dual-Luciferase miRNA Target Expression Vector
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberE1330
Origin of ReplicationColE1-derived plasmid origin of replication
Quantity20microg
PromoterHuman phosphoglycerate kinase promoter
ResistanceAmpicillin
Vector NamepmirGLO
Selectable MarkerAmpicillin

Specifications/Features

Vector Size:
7350 bp

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) CircSMAD4 shapes matrix-remodeling TAMs in lung adenocarcinomaNon-coding RNA ResearchAugust 1, 2026Zhengwei Yu, Xinyue Wang, Yiqian Zheng, Yifan He, Jiayu Lin, Yue Xiao, Bin Mo, Haoyu Xie, Sitong Hang, Xia Gao, et al.binding site and the COL4A1 3′UTR were cloned into the pmirGLO Dual-Luciferase vector (Promega, Cat# E1330) or the psiCHECK-2 vector (Promega, Cat# C8021). Corresponding seed-site mutants and m^6A-site mutants

(2) Heart failure pleural fluid impairs endothelial barrier through miR 501-3p mediated ZO 1 remodelingiScienceMay 15, 2026Chieh-Yung Wang, Tung-Yu Tiong, Ying Chen, Yi-Hsuan Lin, Vijesh Kumar Yadav, Chih-Ying Changchien, Chih-Feng Chian, Chen-Liang Tsaisynthesized ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, pmirGLO Dual-Luciferase Vector,Promega,Cat# E1330 pmirGLO-ZO-1-WT,This study,Not applicable pmirGLO-ZO-1-MUT,This study,Not applicable ,, Software

(3) Reduced YTHDF2 inhibits PD-L1 expression by stabilizing m6A-containing SPOP mRNA in colorectal cancerCell Death & DiseaseMarch 24, 2026Xian Xu, Hao Chen, Rongjie Zhao, Jiansheng Xie, Hao Liu, Binbin Xie, Jun Lou, Haidong Wang, Xinkai Wu, Weidong Han, et al.analyzed by qRT-PCR. Dual-luciferase reporter assay The m6A sites were inserted into the pmirGLO vector (E1330, Promega, WI, USA), which was designed to study their effect on transcript stability. SPOP 3’ untranslated

(4) Synergistic Inhibition of Porcine Reproductive and Respiratory Syndrome Virus by a Bifunctional 5'-PPP miRNA Combining RIG-I Activation with Sequence-Specific Viral TargetingVirusesMarch 20, 2026Zihang Song, Jiabao Hou, Feng Guo, Longping Chen, Chudong Wang, Xinjie Guo, Ping Li, Wenlong Shen, Jiajun Yang, Hongxu Zhong, et al.concatenated and cloned between the SacI and XbaI sites of the pmirGLO vector (Promega, Madison, WI, USA, E1330) to generate pmirGLO-PRRSV. MARC-145 cells were co-transfected with the indicated miRNA and pmirGLO-PRRSV

(5) Exosomal Long Noncoding RNA H19 as a Biomarker and Therapeutic Target in Atrial FibrillationInt J Biol SciMarch 17, 2026Ji-Young Kang, Dasom Mun, Malgeum Park, Gyeongseo Yoo, Nuri Yun, Boyoung Joung(Mut) binding sites for miR-141-3p and miR-200a-3p were amplified and inserted into pmirGLO Vector (E1330; Promega, Madison, WA, USA). HEK293 cells were selected because of their high transfection efficiency

(6) TRMT6-directed m1A modification initiates lung squamous cell carcinoma via YTHDF3-stabilized cell cycle genesnpj Precision OncologyMarch 10, 2026Weihao Xue, Liqiang Zhu, Xiaolong Wei, Jinqi Sun, Weihao Lin, Shaomin Huang, Lianpin Wu, Donghong Zhangand DSN1 mRNA. Then, the serial DNA sequences were inserted into the pmirGLO Dual-Luciferase vector (E1330, Promega) to construct the plasmids of pmirGLO-TOPBP1-m1A-WT, pmirGLO-TOPBP1-m1A-mutant, pmirGLO- DSN1-m1A-WT,

(7) MicroRNA Novel-m0027-3p Negatively Regulates Jhamt Gene and Affects Juvenile Hormone Biosynthesis in Apis mellifera LarvaeInsectsMarch 6, 2026Ning Wang, Si-Jia Deng, Chuan-Lian Zhang, Gen-Chao Gan, Zi-Nuo Li, Min Jiang, Yi-Wen Liu, Hao-Dong Zhao, Jia-Run Yang, Jian-Feng Qiu, et al.sequence (AmJhamt-mut) were synthesized. These sequences were individually cloned into the pmirGLO vector (E1330, Promega, Madison, WI, USA). Bacterial cultures containing the respective monoclonal vectors were subjected

(8) Zuogui Wan alleviated radiation-induced premature ovarian failure and ferroptosis via miR-21-5p/DNMT3bJournal of Ovarian ResearchMarch 3, 2026Yangping Liu, Ming Chen, Meng Li, Zhen Li, Haifu Huangmutant DNMT3b 3’-UTR sequence were inserted into the Dual-Luciferase miRNA Target Reporter Vector (E1330, Promega, Madison, USA) to construct DNMT3b-WT (Wild-type) and DNMT3b-MUT (Mutant), respectively. Luciferase

(9) Target-stabilized base editors enable robust high-fidelity RNA editingNature CommunicationsFebruary 25, 2026Taian Liu, Yunping Lin, Qiwei Liu, Wenhui Liao, Yunyi Lin, Yujing Zhang, Jianqing Zhang, Wenhua Cao, Lixin Yang, Zexuan Hong, et al.sequences are provided in Supplementary Data File 1. The luciferase genes were cloned from pMirGlo (E1330, Promega) and subject to site-directed mutagenesis to induce nonsense mutations, followed by insertion

(10) Thermal Plasticity is Regulated by a Key MicroRNA During Range Expansion of an Invasive Fruit FlyAdvanced ScienceFebruary 24, 2026Yan Zhao, Juntao Hu, Juan Du, Shaokun Guo, Youming Hou, Zhihong LimiR‐276b. A ∼200 bp 3’ UTR with predicted miR‐276b target sites in thw were cloned into the pmirGLO vector (E1330, Promega, USA), downstream of the luciferase gene (creating pmirGLO‐thwconstructs) using SacI and XhoI

(11) Adipocyte‐Derived Exosomal miR‐5099 Mitigates M1 Macrophage Polarization and Adipose Inflammation via c‐Met/NF‐κB Axis to Improve Metabolic HealthAdvanced ScienceFebruary 21, 2026Ping Tang, Lixin Tai, Hongxia Xu, Dongliang Zhu, Jiajia Li, Hao Feng, Jinghui Cui, Shuhai Lin, Li‐jun Di, Li Wangtarget, a luciferase reporter assay was performed with the pmirGLO Dual‐Luciferase Vector (Promega, E1330). The c‐MET 3’untranslated region (UTR), harboring either wild‐type (5’…GAAAGAUUUUGUUCUGAUCUAA…) or

(12) miRNA gene mutations commonly disrupt the proper functioning of miRNA genesScience AdvancesFebruary 20, 2026Magdalena Machowska, Natalia Szostak, Adrian Tire, Wladyslaw Wegorek, Malwina Suszynska, Arkadiusz Kajdasz, Paulina Galka-Marciniak, Anna Philips, Piotr Kozlowskicotransfected cells with either wild-type or mutant expression vectors, along with plasmids pmirGLO (no. E1330, Promega, Madison, WI) containing sequences of a perfect-match or naturally occurring validated targets

(13) LncRNA HOXC-AS3 prevents chondrocyte senescence and osteoarthritis progression through miR-615-3p sponging and RRBP1 interactionCell & BioscienceFebruary 15, 2026Chan Wang, Jun Zhou, Lulu Chen, Changyan Ma, Zhan Dong, Dengshun MiaoCIT 3′UTR were synthesized and inserted into the pmirGLO Dual-Luciferase reporter vector (Promega, E1330). All constructs were verified by DNA sequencing. Cell transfection was performed using Lipofectamine 3000

(14) Exosomal miR-484 from lung adenocarcinoma promotes osteoclastogenesis and osteolytic bone metastasis by targeting PECAM1Discover OncologyFebruary 6, 2026Zhongkai Tong, Xiaoxiao Zhu, Mengqing Hu, Cenli Wang, Xiaofei Liang, Chunli Wu, Zhenyan Li, Lin He, Jian Li, Zhenyue Ye, et al.-luciferase reporter assay Wild-type or mutant PECAM1 3’UTR sequences were cloned into the pmirGLO vector (Promega, #E1330) and co-transfected with miR-484 mimic (RiboBio #miR10003127-1-5) into HEK293T cells (purchased from

(15) Differentiation in the human urothelia is defined by distinct alternative polyadenylationCell ReportsJanuary 27, 2026Ninh B. Le, Surbhi Sona, Briana Santo, Yi Zhang, Rosie Ou, R. Allen Schweickart, Veena Kochat, William I. Padron, Kunal Rai, Shih-Han Lee, et al.heatmaps. Construction of a Dual-Luciferase reporter system The pmirGLO Dual-Luciferase vector (Promega #E1330) was linearized by XbaI (NEB #R0145). 3′ UTR sequences containing 20 bp overlaps flanking the XbaI site

(16) let-7c-5p promotes fracture healing by downregulating CDK8Journal of Orthopaedic Surgery and ResearchJanuary 24, 2026Wei Liu, Jinxiang Zhang, Xi Chen, Bin Cheng, Qiang Li, Lin Li, Hongbin Yangbinding site and its mutants were directionally cloned into the pmirGLO dual-reporter vector (Cat# E1330, Promega, USA). Wild-type (CDK8-WT) and mutant (CDK8-MUT) recombinant plasmids were constructed. let-7c-5p

(17) tRNA m2G methyltransferase complex THUMPD3-TRMT112 promotes pancreatic cancer progression and autophagy via modulating TFEB translationMolecular CancerJanuary 13, 2026Wenbin Yuan, Shi Li, Yue Xi, Rui Tian, Yuan Liu, Xingyu Chen, Rui Zhang, Hao Lyu, Shuai Xiao, Dong Guo, et al.inserted upstream of the luciferase (Firefly) gene in the pmiRGLO dual-luciferase vector (Promega, E1330). HEK293T cells were co-transfected with luciferase reporter plasmids along with either THUMPD3/TRMT112

(18) Selective blockade of microRNA-31-5p/calcitonin receptor interaction reverses established atrial fibrosis and atrial arrhythmia substrateResearch SquareJanuary 8, 2026Jasha Trompf*, Kathryn Cox*, Mohit Hulsurkar*, Lucia M. Moreira, Chi Him Kendrick Yiu, Aaron M. Johnston, Satadru K. Lahiri, Shuai Zhao, Paul Robinson, Roddy Hiram, et al.reporter construct was generated using the pmirGLO Dual-Luciferase miRNA Target Expression Vector (#E1330, Promega) containing the whole length (1869 bp) of CALCR 3′UTR. Please see Supplementary Materials for

(19) FOXP3-activated KCNMB2-AS1 promotes clear cell renal cell carcinoma through the miR-744-3p/CD1D axisCell DivisionDecember 19, 2025Geng Huang, Dingwen Gui, Yankuang Guo, Shuai Luo, Zuwei Xupredicted miR-744-3p binding sites were cloned into the pmirGLO Dual-Luciferase Reporter Vector (Cat. No. E1330, Promega, WI, USA). A498 and 769-P cells were co-transfected with the corresponding KCNMB2-AS1/CD1D-Wt

(20) CircRNA circ_0004058 Modulates Early Brain Injury in Subarachnoid Hemorrhage Through miR-221-3p and VE1 Activation PathwayTranslational Stroke ResearchDecember 1, 2025Hua Gu, Yong Caicells. Luciferase Assay The 3′-untranslated region (3'-UTR) of the LYVE1 gene was cloned into the pmirGLO vector (E1330, Promega Corporation, Madison, WI, USA) and named LYVE1-wild type (WT). An LYVE1 construct with mutations

Be the First to Write a Review!