TaqI-v2 from New England Biolabs

Product Specs
ItemTaqI-v2
CompanyNew England Biolabs
Price $69.00 Inquire
Catalog NumberR0149S
Quantity4000 units
Concentration20-100 u/µL
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

T/CGA

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Genomic identification of direct seeding and evolutionary lineages by combining heterogeneous genomic resourcesBMC BiologyDecember 12, 2025Jasmine Noëlle Tschan, Oliver Reutimann, Simone Fior, Amandine Cornille, Anamaria Roman, Tudor-Mihai Ursu, Alex Widmer, Martin C. Fischerperformed double digestion on 51 ng of DNA per sample with EcoRI-HF (NEB R3101S) and Taq I-v2 (NEB R0149S) restriction enzymes (0.4 µl each) from New England Biolabs (NEB, Ipswich, Massachusetts, USA) in a

(2) The DNA demethylase TET1 modifies the impact of maternal folic acid status on embryonic brain developmentEMBO reportsJanuary 1, 2025Chen L, van der Veer BK, Chen Q, Champeris Tsaniras S, Brangers W, Kwak HHM, Khoueiry R, Lei Y, Cabrera R, Gross SS, et al.the coverage, we performed double digestion using MspI (Supplied with the Nugen Kit) and TaqI (NEB, R0149S) in each sample, first with MspI digestion at 37 °C for 60 min, followed by TaqI digestion at 65 °C

(3) Heat Shock Factor 1 forms nuclear condensates and restructures the yeast genome before activating target geneseLifeOctober 15, 2024Linda S Rubio, Suman Mohajan, David S Gross,Concanavalin A,Sigma-Aldrich,Cat# C2010, "Peptide, recombinant protein",TaqI restriction enzyme,New England Biolabs,Cat# R0149L, Commercial assay or kit,Quick Ligation Kit,New England Biolabs,Cat# M2200L, "Software, algorithm",FIJI/ImageJ,https://imagej.net/software/fiji/,, "Software,

(4) Substrate promiscuity of key resistance P450s confers clothianidin resistance while increasing chlorfenapyr potency in malaria vectorsCell ReportsAugust 27, 2024Magellan Tchouakui, Sulaiman S. Ibrahim, Mersimine K. Mangoua, Riccado F. Thiomela, Tatiane Assatse, Sonia L. Ngongang-Yipmo, Abdullahi Muhammad, Leon J.M. Mugenzi, Benjamin D. Menze, Themba Mzilahowa, et al.marker,TTATCCGTAACTCAATAGCGATG, "Restriction enzyme for CYP6Pa: Taq I (cut site, 5′-TCGA-3′)",New England Biolabs,Cat# R0149S Restriction enzyme for CYP6Pb: NmuCl (Tsp45I) (cut site 5′-GTSAC-3′),New England Biolabs,Cat# R0583S ,, Software

(5) Emergent ribozyme behaviors in oxychlorine brines indicate a unique niche for molecular evolution on MarsNature CommunicationsMay 20, 2024Tanner G. Hoog, Matthew R. Pawlak, Nathaniel J. Gaut, Gloria C. Baxter, Thomas A. Bethel, Katarzyna P. Adamala, Aaron E. Engelhartin 1X ThermoPol Buffer (New England BioLabs Inc. Cat#B9004S). TaqI-v2 ((New England BioLabs Inc. Cat#R0149S) was assessed with the same protocol but in 1X rCutSmart Buffer (New England BioLabs Inc. Cat#B6004S)

(6) Disease-causing Slack potassium channel mutations produce opposite effects on excitability of excitatory and inhibitory neuronsCell reportsMarch 26, 2024Wu J, Quraishi IH, Zhang Y, Bromwich M, Kaczmarek LK.conditions. Following amplification, a restriction cut was performed with the enzyme TaqI-v2 (NEB, R0149S) to distinguish WT (196 and 112 bp products after cut), R455H heterozygous (112, 196, and 308 bp products)

(7) Exploring the Influence of VDR Genetic Variants TaqI, ApaI, and FokI on COVID-19 Severity and Long-COVID-19 SymptomsJournal of Personalized MedicineNovember 28, 2023Ghayda’ Alhammadin, Yazun Jarrar, Abdalla Madani, Su-Jun LeeKorea). For the PCR-RFLP analysis, the restriction enzymes FokI (cat. no. R0109S) and TaqI-v2 (cat. no. R0149S) were obtained from New England Biolabs (Ipswich, MA, USA); ApaI (cat. no. R6361) was purchased from

(8) The maize gene maternal derepression of r1 encodes a DNA glycosylase that demethylates DNA and reduces siRNA expression in the endospermThe Plant CellSeptember 27, 2022Jonathan I Gent, Kaitlin M Higgins, Kyle W Swentowsky, Fang-Fang Fu, Yibing Zeng, Dong won Kim, R Kelly Dawe, Nathan M Springer, Sarah N Andersonmdr1 was amplified by PCR with primers W22-Ros1-F1 and W22-Ros1-R1 and digested with TaqI-v2 (NEB #R0149S). See Supplemental Table S2 for primer sequences. The different mdr1 alleles could be distinguished

(9) The Mechanosensitive Ion Channel MSL10 Potentiates Responses to Cell Swelling in Arabidopsis SeedlingsSSRN Electronic JournalApril 3, 2022Debarati Basu, Elizabeth S. Haswellmicroplates, clear Greiner Bio-One Cat# 651161 TaqI-v2, restriction enzyme New England Biolabs Cat# R0149L Immobilon-P PVDF transfer membrane EMD Millipore Cat# IPVH00010 Other RESOURCE AVAILABILITY Lead

(10) Cavin4 interacts with Bin1 to promote T-tubule formation and stability in developing skeletal muscleJournal of Cell BiologyDecember 6, 2021Harriet P. Lo et al.confirmed by Sanger sequencing (Australian Genome Research Facility, Brisbane) or digestion with αTaqI (#R0149S; NEB). Morphometrics of live zebrafish Images of anesthetized embryos were captured on an Olympus

(11) ROR2 Is Epigenetically Regulated in Endometrial CancerCancers (Basel)January 21, 2021Dongli Liu, Luis Enriquez, Caroline E. Ford(F-AGGAAATGTTTAGGA AAATAAATAGGT, R-AAAACAAACAACTAAAATACTAAAAA) and digested with TaqI restriction enzyme mix (#R0149S, NEB, Ipswich, MA, USA). The targeted region as well as the two CpG sites (cg03900646 and cg14145355)

(12) The Mechanosensitive Ion Channel MSL10 Potentiates Responses to Cell Swelling in Arabidopsis SeedlingsCurrent BiologyJuly 1, 2020Debarati Basu, Elizabeth S. Haswellmicroplates, clear Greiner Bio-One Cat# 651161 TaqI-v2, restriction enzyme New England Biolabs Cat# R0149L Immobilon-P PVDF transfer membrane EMD Millipore Cat# IPVH00010 Other RESOURCE AVAILABILITY Lead

(13) Anosmin1 Shuttles Fgf to Facilitate Its Diffusion, Increase Its Local Concentration, and Induce Sensory OrgansDevelopmental CellSeptember 1, 2018John Wang, Yandong Yin, Stephanie Lau, Jagadish Sankaran, Eli Rothenberg, Thorsten Wohland, Martin Meier-Schellersheim, Holger Knaut,New England Biolabs,R0620L AciI,New England Biolabs,R0551S ApoI,New England Biolabs,R0566L Taqαi,New England Biolabs,R0149L Brefeldin A,Sigma Aldrich,B7651–5MG Critical Commercial Assays,Critical Commercial Assays,Critical

(14) Imprinted gene dysregulation in a Tet1 null mouse model is stochastic and variable in the germline and offspringDevelopmentJanuary 1, 2018Jennifer M. SanMiguel, Lara K. Abramowitz, Marisa S. Bartolomeiinactivation; Peg3, MnlI (NEB, R0163S), 37°C for 3 h, heat inactivated at 65°C for 20 min; Cdkn1c, Taq αI (NEB, R0149S), 65°C for 1 h, heat inactivated for 20 min at 80°C; Kcnq1ot1, StuI (NEB, R0187S), 37°C for 3 h, no

(15) Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seqNature ProtocolsJune 1, 2016Hao Wu, Xiaoji Wu, Yi ZhangEN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo–, 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs

(16) Mitochondrial Involvement in Vertebrate Speciation? The Case of Mito-nuclear Genetic Divergence in ChameleonsGenome Biology and EvolutionDecember 1, 2015Dan Bar-Yaacov, Zena Hadjivasiliou, Liron Levin, Gilad Barshad, Raz Zarivach, Amos Bouskila, Dan Mishmarrestriction mix and conditions): POLRMT (mutation at position 1218)—both TaqαI (New England BioLabs #R0149S) and MlucI (New England Biolabs #R0538S); MRPL30—PstI (New England BioLabs #R0140S); ETFA—HindIII (Thermo

(17) COBRA-Seq: Sensitive and Quantitative Methylome ProfilingGenes (Basel)October 23, 2015Hilal Varinli, Aaron L. Statham, Susan J. Clark, Peter L. Molloy, Jason P. Rossamplified and purified 2 μg library material was then digested overnight with 100 U of TaqI (NEB, cat#R0149S) in NEB buffer 4 in a final volume of 100 μL at 65 °C. After TaqI digest, there are three main fragment

(18) In silico analysis identifies novel restriction enzyme combinations that expand reduced representation bisulfite sequencing CpG coverageBMC Research NotesDecember 1, 2014Daniel B Martinez-Arguelles, Sunghoon Lee, Vassilios Papadopoulosnumber AluI,AG|CT,37,CutSmart,80,No,R0137S BfaI,C|TAG,37,CutSmart,80,No,R0568S HaeIII,GG|CC,37,CutSmart,80,No,R0108S HpyCH4V,TG|CA,37,CutSmart,65,No,R0620S MluCI,|AATT,37,CutSmart,No,No,R0538S MseI,T|TAA,37,CutSmart,65,No,R0525S MspI,C|CGG,37,CutSmart,No,No,R0106S TaqI,T|CGA,65,CutSmart,80,dam,R0149S CviQI,G|TAC,25,NEB 3.1,No,No,R0639S CviAII,C|ATG,25,CutSmart,65,No,R0640S ApeKI,G|CWGC,75,NEB 3.1,No,Yes,R0643S Properties

(19) Association between Polymorphisms of Interleukin-17A and Interleukin-17F Genes and Silicosis Susceptibility in Chinese Han PeopleAsian Pacific Journal of Cancer PreventionNovember 7, 2014Ying Chen, Xue-Yun Fan, Yu-Lan Jin, San-Qiao Yao, Xiang Yun, Zheng-Bing Hua, Fu-Hai ShenI46.8 (New England Biolabs, Beverly, MA, 51.1 types of fragments: 359bp, 206bp+152bp into three 51.7 USA, R0149S) for the A-832G, 54.2 and digested in 37℃ for and 359bp+206bp+152bp, as shown in Figure 1A. 31.3 15

(20) Carnitine Palmitoyltransferase 1B 531K Allele Carriers Sustain a Higher Respiratory Quotient after Aerobic Exercise, but ß3-Adrenoceptor 64R Allele Does Not Affect Lipolysis: A Human ModelPLoS ONEJune 6, 2014Eduardo Gómez-Gómez, Martín Efrén Ríos-Martínez, Elena Margarita Castro-Rodríguez, Mario Del-Toro-Equíhua, Mario Ramírez-Flores, Ivan Delgado-Enciso, Ana Lilia Pérez-Huitimea, Luz Margarita Baltazar-Rodríguez, Gilberto Velasco-Pineda, Jesús Muñiz-Murguía

Be the First to Write a Review!

TaqI-v2

TaqI-v2 from New England Biolabs

Sequence

New England Biolabs

Citations (21)

Reviews

TaqI-v2 from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map