GoTaq DNA Polymerase from Promega

Product Specs
ItemGoTaq DNA Polymerase
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM3005
Quantity500u
Concentration5 U/µl
Molecular Weight~100kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) De novo promoters emerge more readily from random DNA than from genomic DNASci AdvMay 29, 2026Timothy Fuqua, Andreas Wagnerμl of H2O, 2 μl of 5× GoTaq reaction buffer, 0.2 μl of GoTaq polymerase (Promega, USA, product no. M3001), 0.1 μl of primer pMR1_insert_forward, 0.1 μl of primer pMR1_insert_reverse, 0.2 μl of dNTPs (Thermo

(2) Biobank of genetically defined murine prostate cancer tumoroids uncovers oncogenic pathways and drug vulnerabilities driven by PTEN-lossCell Reports MethodsApril 20, 2026Jessica Kalla, Thomas Dillinger, Zlata Pavlovicova, Reema Jacob, Emine Atas, Katarina Mišura, Anil Baskan, Kristina Draganić, Andreas Tiefenbacher, Tanja Limberger, et al.performed to confirm the genotype of all used organoids and tumoroids using GoTaq DNA Polymerase (Promega #M3001) and primers specific for targets of interest (Table S1). Thermal cycling conditions were optimised

(3) KLF5 controls subtype-independent highly interactive enhancers in pancreatic cancer to regulate cell survivalSci AdvMarch 20, 2026Thomas L. Ekstrom, Zhangshuai Dai, Julia Thiel, Akshay Kanakan, Bishakha Joyeeta Saha, Meghana Manjunath, Nadine Schacherer, Pavlos Bousounis, Emily L Siegler, Amro M. Abdelrahman, et al.out from 200 ng of extracted DNA per the manufacturer’s protocol with GoTaq DNA Polymerase (Promega, M3001) and PCR nucleotide mix (Promega, C1141). Lentiviral production and infection HEK293T cells were plated

(4) Role of MeCP2 in Shaping the Histopathological Heterogeneity of Ampullary CarcinomaACTA HISTOCHEMICA ET CYTOCHEMICAFebruary 27, 2026Teruyuki Ohno, Riko Kitazawa, Ryuma Haraguchi, Mashio Taniwaki, Yuki Takaoka, Keiko Hiraki-Kamon, Hidemasa Kato, Sohei Kitazawaand encapsulated in agarose beads. PCR amplification employed GoTaq DNA polymerase (Promega, cat. no. M3001, Madison, WI, USA). The resulting PCR products were purified using the NucleoSpin Gel and PCR Clean-up

(5) LZTR1 Loss Reduces Vimentin Expression and Motility in Hep3B Hepatocellular Carcinoma CellsInternational Journal of Molecular SciencesFebruary 15, 2026Gökhan Yıldız, Soner Karabulut, Umit Uzun, Onur Obut, Vahap Eldem, Tuba Dinçer, Bayram ToramanPCR reactions were performed in a total volume of 25 µL, containing 0.1 µL Go Taq DNA polymerase (Cat. No: M3001; Promega), 5 µL 5× GoTaq Buffer, 1.3 µL genomic DNA (350 ng/µL), 1.5 µL MgCl2 (25 mM), 0.6 µL 10 mM

(6) Burkholderia pseudomallei in Colombia: Laboratory Approaches to Enhance Diagnostic AccuracyInt J MicrobiolOctober 5, 2025Soraya Morales-Lopez, Yeneiris Villero Wolf, Deyner Lechuga, Luis Caicedo, Yiceth Acosta Triana, Liliana Gomez, Luis Rodrigo Ramirez, Leandro Narvaez, Heidy Pinzon, Kelin Esquea, et al.DNA; 0.2 mM of each dNTP; 1X Pol Buffer C; 1.5 mM MgCl2; 0.75 unit MyTaq DNA Polymerase (Promega, cat M3001, United States); 0.2 μM primers 16F, 16R, 32F, 32R, 71F, and 71R; and 0.3 μM primers 51F and 51R. The

(7) Environmental stress promotes the persistence of juvenile traits in olfactory neurons as a protective mechanismiScienceAugust 15, 2025Brechbühl J, Lopes AC, Wood D, Sauge E, Sidhom M, Gilliand N, Nenniger Tosato M, Gachon F, Broillet MC.-Bromo-2′-deoxy-uridine Labeling and Detection Kit I,Roche,Cat# 11296736001 RNeasy Plus Mini Kit,Qiagen,Cat# 74134 GoTaq® DNA Polymerase,Promega,Cat# M3001 Fast SYBR Green Master Mix,Thermo Fisher Scientific,Cat# 4385617 PrimeScript™ 1st strand cDNA Synthesis Kit

(8) Engineering a Cell-Based Orthogonal Ubiquitin Transfer Cascade for Profiling the Substrates of RBR E3 ParkiniScienceJuly 18, 2025Shuai Fang, Li Zhou, Geng Chen, Jing Zhang, Xiaoyu Wang, In Ho Jeong, Savannah E. Jacobs, Bradley R. Kossmann, Wei Wei, Shu Liu, et al.A1113802 Antimycin,Sigma-Aldrich,Cat# A8674 Oligomycin,Sigma-Aldrich,Cat# 75351 Taq DNA polymerase,Promega,Cat# M3001 Ni SepharoseÔ High Performance,GE Healthcare,Cat# 17-5268-01 PierceTM high-capacity streptavidin agarose

(9) GSK-3β and mTOR Phosphorylation Mediate the Reversible Regulation of Hypomagnetic Field on Adult Neural Stem Cell ProliferationEur J NeurosciJuly 17, 2025Jie Ren, Fulai Li, Jianxun Shen, Lanxiang Tian, Yongxin Pan(Promega, A5001, United States). Standard RT‐PCR was performed using GoTaq DNA polymerase (Promega, M3001, United States). To quantify the mRNA levels using real‐time PCR, aliquots of first‐stranded cDNA were

(10) Uncovering novel lncRNAs linked to melanoma growth and migration with CRISPR-inhibition screeningCancer Research CommunicationsJuly 1, 2025Stavroula Petroulia, Kathryn Hockemeyer, Shashank Tiwari, Pietro Berico, Sama Shamloo, Seyedeh Elnaz Banijamali, Eleazar Vega-Saenz de Miera, Yixiao Gong, Palaniraja Thandapani, Eric Wang, et al.Transcription Kit (Thermo Fisher Scientific, #4368814), and qPCR was performed with GoTaq (Promega, #M3001) according to the manufacturer’s instructions with primer sets listed in Supplementary Table S5 and

(11) Uncovering Novel lncRNAs Linked to Melanoma Growth and Migration with CRISPR Inhibition ScreeningCancer Res CommunJuly 1, 2025Stavroula Petroulia, Kathryn Hockemeyer, Shashank Tiwari, Pietro Berico, Sama Shamloo, Seyedeh Elnaz Banijamali, Eleazar Vega-Saenz de Miera, Yixiao Gong, Palaniraja Thandapani, Eric Wang, et al.Transcription Kit (Thermo Fisher Scientific, #4368814), and qPCR was performed with GoTaq (Promega, #M3001) according to the manufacturer’s instructions with primer sets listed in Supplementary Table S5 and

(12) Harnessing endogenous miRNA targeting ZIKV: A cutting-edge strategy to inhibit virus infectionMolecular Therapy Nucleic AcidsJune 10, 2025Rhubia S.M. Rosa, Soledad Palameta, Jessica M. Toscaro, Michael E. Miller, Paulo S. Lopes-de-Oliveira, Marcio C. Bajgelmanwere generated by cloning a PCR fragment amplifyed from gDNA of human 293T cells, using Promega kit (M3001) following manufacturer protocol. We designed oligonucleotides to amplify the fragment harboring the

(13) Perinatal death in pig models of hypertrophic cardiomyopathy carrying sarcomere pathogenic variantsJournal of Molecular and Cellular Cardiology PlusJune 1, 2025Tatiana Flisikowska, Björn Petersen, Giulia Mearini, Daniela Huber, Mayuko Kurome, Melanie Stoff, Saskia Schlossarek, Andrea Lucas-Hahn, Eckhard Wolf, Judith Montag, et al.(5’–CAATGGGCATGAAGGGCTGG–3′), resulting in an amplicon of 812 bp. All PCRs were carried out using GoTaq polymerase (Promega, M3005) with the following thermal cycling parameters: 2 min, 95 °C then 35 cycles of: 30 s, 95 °C; 30 s, 60

(14) The latent cis-regulatory potential of mobile DNA in Escherichia coliNat CommunMay 21, 2025Timothy Fuqua, Andreas Wagnerhttps://github.com/tfuqua95/promoter_emergence_mobile_DNA Error-prone PCR To create the mutagenesis library, we prepared a 100 uL GoTaq (Promega, USA, product #M3001) polymerase chain reaction (PCR). For this reaction, we added 1 uL of the forward and reverse primer

(15) A homozygous human WNT11 variant is associated with laterality, heart and renal defectsDisease Models & MechanismsMay 1, 2025Henrike Berns, Damian Weber, Maximilian Haas, Zeineb Bakey, Magdalena Maria Brislinger-Engelhardt, Miriam Schmidts, Peter WalentekDNA, 50 pM of each primer, 2 mM deoxynucleotide triphosphates and 1.0 U GoTaq DNA polymerase (Promega, M3001). PCR amplifications were carried out by an initial denaturation step at 94°C for 3 min, and 33 cycles

(16) Spontaneous lung colonization in the cystic fibrosis rat model is linked to gastrointestinal obstructionmBioApril 9, 2025Mikayla Murphree-Terry, Johnathan D. Keith, Ashley M. Oden, Susan E. Birketof bacterial isolates. DNA was added to a mixture containing Promega GoTaq DNA Polymerase (Promega M3001, Fisher Scientific, Waltham, MA, USA), 5× colorless GoTaq Reaction Buffer (Promega M3001, Fisher Scientific,

(17) The gain-of-function UBE3AQ588E variant causes Angelman-like neurodevelopmental phenotypes in miceSci RepMarch 17, 2025Kellan P. Weston, Anna M. Gunelson, Susan E. Maloney, Xia Ge, Jalin A. Stelzer, Kwang-Soo Kim, Shylyn Collier, Marissa M. Mindt, Megan J. Agajanian, Michael B. Major, et al.R-5’- GACTATGCCAATCAGAGTAAACTC-3’ (285 bp). PCR was performed using GoTaq DNA polymerase (Promega #M3001) with the following thermocycler conditions: Denaturation at 95 °C for 10 min, followed by 28 cycles

(18) Pre-clinical safety and efficacy of human induced pluripotent stem cell-derived products for autologous cell therapy in Parkinson's diseaseCell stem cellMarch 6, 2025Jeon J, Cha Y, Hong YJ, Lee IH, Jang H, Ko S, Naumenko S, Kim M, Ryu HL, Shrestha Z, et al.SsoAdvanced™ Universal SYBR® Green Supermix,Bio-Rad Laboratories,Cat#1725275 GoTaq® DNA Polymerase,Promega,Cat#M3001 PCR Master Mix,Promega,Cat#M7502 DNeasy Blood & Tissue Kit,Qiagen,Cat#69504 Venor GeM Mycoplasma

(19) TDP43 autoregulation gives rise to dominant negative isoforms that are tightly controlled by transcriptional and post-translational mechanismsCell ReportsJanuary 28, 2025Megan M. Dykstra, Kaitlin Weskamp, Nicolás B. Gómez, Jacob Waksmacki, Elizabeth Tank, M. Rebecca Glineburg, Allison Snyder, Emile Pinarbasi, Michael Bekier, Xingli Li, et al.PCR for the CFTR assay was performed using 1 μL of cDNA as a template, GoTaq DNA Polymerase (Promega, M3001), and primers described in Table S1. qRT-PCR RNA was isolated using the Direct-zol RNA Miniprep Kit

(20) Protein family FAM241 in human and mouseMammalian GenomeDecember 23, 2024Quinlan Doctrove, Young Park, Daniel G. Calame, Jacob Kitzman, Guy M. Lenk, Miriam H. Meislerfrom Takara Inc. (# 636525 Lot 2206522 A) and analyzed by RT-PCR with Promega GoTaq DNA polymerase (M3005), Green GoTaq Reaction Buffer (M3005), and Invitrogen dNTPs (10297018). Primer sequences are given in

Be the First to Write a Review!