FastStart Universal SYBR Green Master (Rox) from Roche

Product Specs
ItemFastStart Universal SYBR Green Master (Rox)
CompanyRoche
Price Get Pricing Get Quote for this Product
Catalog Number04913850001
Quantity4 x 1.25 ml for 500 reactions of 20 µl final reaction volume

Add to Compare List

Roche

Roche Diagnostics Corporation P.O. Box 50414 9115 Hague Road

Indianapolis, Indiana

United States

Phone: +1-800-262-1640
Fax: +1-800-428-2883
Technical Service Phone: +1-800-262-4911

Company Profile

Website: sequencing.roche.com

(1) Transcriptional Analysis of Cell Division-Related Genes in Weizmannia coagulans BC99 Under Low pH ConditionsMicroorganismsApril 8, 2026Yanqi Zhang, Pengyan Li, Lijuan Wang, Jianrui Sun, Shanshan Tie, Ying Wu, Dahong Wang, Jie Zhang, Shaobin Guconducted on a LightCycler® 96 real-time PCR system using FastStart Universal SYBR Green Master (Roche, 04913850001, Basel, Switzerland). The relative expression levels of target genes were determined using the comparative

(2) Oxidative Stress Footprints in Bone Marrow Mesenchymal Stem Cells from Untreated Advanced Breast CancerOncology ResearchMarch 23, 2026Francisco Raúl Borzone, María Belén Giorello, Agustina Freire, Leandro Marcelo Martinez, Leonardo Feldman, Federico Dimase, Pablo Evelson, Irene Larripa, Emilio Batagelj, Marcela Beatriz González Cid, et al.generate copy DNA (cDNA). Quantitative PCR was performed in duplicate using SYBR Green master mix (cat. 04913850001, ROCHE, Mannheim, Germany) on a real-time PCR system (CFX96™ TOUCH REAL-TIME PCR, Bio-Rad, Hercules,

(3) LSD1 ablation promotes mammary tumor metastasis by attenuating NK cell-mediated anti-tumor immunitybioRxivMarch 18, 2026Dongxi Xiang, Sen Han, Aina He, Guyu Qin, Roderick T. Bronson, Zhe LiiScript cDNA synthesis kit (Bio-RAD, 170–8891). Quantitative RT-PCR was performed using FastStart SYBR Green Master (Roche, 04913850001, IN). The primer sequences are listed below for qRT-PCR 37, 38, 67: CRISPR/Cas9 lentiviral vectors

(4) Chromatin remodeling factor BAF155 coordinates oligodendroglial-neuronal communications linked to regional myelination and autism-like behavioral deficits in miceNature CommunicationsDecember 21, 2025Xiaorui Wang, Cong Zeng, Zhonghao Wu, Minmin Lu, Xiao Wang, Yun Xiu, Qi Wang, Shouyu Wang, Xiaoying Chen, Yan Shen, et al.transcription. The Accurate 96 Real Time PCR System (DLAB) and FastStart Universal SYBR Green Master Mix (Roche, 04913850001) were used for the qPCR experiment. All primer sequences are presented in Supplementary Data 2. In situ hybridization

(5) Peptidyl-tRNA hydrolase 2 is a negative regulator of peripartum cardiomyopathy with heart failure in female miceNature CommunicationsDecember 19, 2025Vanessa Montoya-Uribe, Pooja Choubey, Chad B. Walton, Natalija Glibetic, Won Seok Yang, Femke J. Aan, Sarah Lindsey, Karolina Peplowska, Brenda Y. Hernandez, Joe W. Ramos, et al.the genes of interest was performed in triplicate using FastStart Universal SYBR Green Master (ROX) (04913850001, Roche, Basel, Switzerland). PCR temperature and cycling conditions involved: a pre-incubation cycle

(6) A C-terminal cytoplasmic retention motif and nuclear localization signal regulates nuclear import of TP53INP2/DORJ Cell SciDecember 10, 2025Birendra Kumar Shrestha, Eva Sjøttem, Hallvard Lauritz Olsvik, Isaac Odonkor, Aud Øvervatn, Hanne Britt Brenne, Jack-Ansgar Bruun, Trond Lamark, Terje Johansen05893151001). The real time qPCR was performed using FastStart Universal SYBR Green Master Mix (Roche, Cat.no. 04913850001) on a LightCycler® 96 Real-Time PCR system (Roche). The primers used were as follows: 47S rRNA, forward

(7) Dasatinib Inhibits Basal B Breast Cancer Through ETS1-Mediated Extracellular Matrix RemodelingBiomedicinesNovember 26, 2025Xinyu Guo, Heng Sun, Feng Yu, Yangyang Feng, Sen Guo, Josh Haipeng Lei, Kai Miao, Ka-U Ip, Ling Li, Hanghang Li, et al.Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using FastStart SYBR Green Master Mix (Roche, 04913850001, South San Francisco, CA, USA) and quantified on a QuantStudio™ 7 Flex Real-Time PCR System (Thermo

(8) B7 homolog 6 promotes the killing activity of natural killer cells against cervical cancer through the downstream ERK pathway of NKp30Translational Cancer ResearchOctober 31, 2025Ruimeng Guo, Ou Chai, Changying Li, Yanying Xu, Xuewang GuoThermo Fisher Scientific, Inc. Next, RT-qPCR was performed using FastStart Universal SYBR Green Master Mix (cat. no. 04913850001; Roche Diagnostics, Basel, Switzerland), following the manufacturer’s instructions. An initial amplification

(9) Convergent evolution of H4K16ac-mediated dosage compensation in the ZW species Artemia franciscanaPLoS GenetOctober 9, 2025Frederic Zimmer, Annika Maria Fox, Qiaowei Pan, Frank Rühle, Peter Andersen, Ann-Kathrin Huylmans, Tanja Schwander, M. Felicia Basilicata, Claudia Isabelle Keller Valsecchi300 nM final primer concentration with the FastStart Universal SYBR Green Master (ROX) mix (Roche, 04913850001). The reaction was run in the LightCycler 480 2 (Roche, 05015243001) with the cycling conditions as

(10) Gadd45B Deficiency Drives Radio-Resistance in BRAFV600E-Mutated Differentiated Thyroid Cancer by Disrupting Iodine Metabolic GenesCancers (Basel)September 30, 2025Shan Jiang, Zhiwen Hong, Qianjiang Wu, Rouhan A, Zhaobo Wang, Xue Guan, Xinghua Wang, Ari A. Kassardjian, Yali Cui, Tengchuang MaGene expression analysis was performed in triplicate using FastStart Universal SYBR Green Master with ROX (#04913850001; Roche Applied Science, Indianapolis, IN, USA) on an Applied Biosystems 7900HT Fast Real-Time PCR System.

(11) Senescence‑associated IL‑33 secretion undermines sorafenib efficacy in hepatocellular carcinoma via immune evasionOncology ReportsSeptember 15, 2025Yu-Xin Lin, Hsien Liu, Wei-Chiao Liao, Yi-Ching Wang, Bo-Cheng Zhang, Shu-Wen Wan, Chien-Chin Chen, Chih-Peng Chang(enzyme inactivation). qPCR was performed with the FastStart Universal SYBR Green Master (Rox) (cat. no. 04913850001; Roche Diagnostics) in the StepOnePlus™ Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific,

(12) Sex-specific transcriptome dynamics of Anopheles gambiae during embryonic developmentGenes & DevelopmentSeptember 2, 2025Agata Izabela Kalita, Eric Marois, Frank Rühle, Claudia Isabelle Keller Valsecchiisolation from one lysate. PCR was performed with FastStart Universal SYBR Green master (ROX) mix (Roche 04913850001) using Y-linked repeats (S23) (Krzywinski et al. 2004) as template and autosomal repeats (Ag404) (Krzywinski

(13) An FGFR-p53 developmental signaling axis drives salivary cancer progressionOncogeneAugust 25, 2025Adele M. Musicant, Julia M. R. Billington, Jeffrey S. Damrauer, Jennifer L. Modliszewski, Luane J. B. Landau, Yi-Hsuan Tsai, Jay H. Mehta, John Powers, Renee Betancourt, Radhika Sekhri, et al.normalized to mouse Rpl23. qPCR was performed using FastStart Universal SYBR Green Master (Rox) Mix (Roche #04913850001) with 1/50 (tissue) or 1/100 (cells) volume of the cDNA iScript reaction, and 0.25 μM of primers. All

(14) Glioma promotes macrophage immunosuppressive phenotype through ANXA1 in a methionine metabolism-dependent mannerDiscov OncolJuly 6, 2025Hong Hu, Yishuai Huang, Jiafeng Li, Ruijie Liu, Honglei Li, Meng Cai, Hao Chen, Ning Wang, Shuo Yang, Kaikai Wang, et al.Basel, Switzerland). The reaction was set up using the FastStart Universal SyBR Master Mix (Roche, cat#04913850001, Basel, Switzerland), and qRT-PCR was performed using ABI Prism 7500 rapid thermocycler (Applied Biosystems,

(15) The RNA-Binding Proteins MCPIP2 and IGF2BP1 Competitively Modulate Breast Tumor Angiogenesis by Antagonizing VEGFA mRNA Stability and ExpressionFASEB JMay 31, 2025Wenbao Lu, Hongwei Li, Xueting Liu, Ailing Li, Ruijuan Xiutissues or cultured cells and reverse transcribed to cDNA for qPCR using SYBR green Fast Master Mix (#04913850001; Roche, Basel, Switzerland). Gene expression levels were based on the ∆∆Ct method and normalized to

(16) S100PBP interacts with nucleoporin TPR and facilitates XY crossover formation in miceEMBO ReportsApril 9, 2025Yufan Wu, Yang Li, Huan Zhang, Jingwei Ye, Ming Li, Jianteng Zhou, Xuefeng Xie, Hao Yin, Min Chen, Gang Yang, et al.and 30 s at 72 °C. The qPCR was performed with FastStart Universal SYBR Green Master (ROX) (Roche, 04913850001) using a StepOne Real-Time PCR System (Applied Biosystems). The qPCR reactions were performed under

(17) Mdga2 deficiency leads to an aberrant activation of BDNF/TrkB signaling that underlies autism-relevant synaptic and behavioral changes in micePLoS BiolApril 1, 2025Dongdong Zhao, Yuanhui Huo, Naizhen Zheng, Xiang Zhu, Dingting Yang, Yunqiang Zhou, Shengya Wang, Yiru Jiang, Yili Wu, Yun-Wu ZhangQuantitative real-time PCR was performed using FastStart Universal SYBR Green Master Mix (ROX) (Roche, Cat# 04913850001) in combination with relevant gene-specific primers; β-actin served as an internal control. PCR primers

(18) Proteomic analysis reveals the alleviation of follicular development defects in offspring mice under DEHP exposure by melatoninBMC BiologyFebruary 28, 2025Jing-Cai Liu, Yuan-Jing Zou, Kun-Huan Zhang, Yi-Ming Ji, Yue Wang, Shao-Chen Sunprepared according to the instructions of FastStart Universal SYBR Green Master (ROX) reagent (Roche, 04913850001, Mannheim, Germany). Relative quantitative analysis was performed on a QuantStudio 5 instrument. The

(19) Dissolving microneedle patch loaded with adipokines-enriched adipose extract relieves atopic dermatitis in mouse via modulating immune disorders, microbiota imbalance, and skin barrier defectsJ Tissue EngFebruary 6, 2025Jingyan Guan, Kaiqi Chen, Feng Lu, Yunfan HeBioscience, Hennigsdorf, Germany). Then using a FastStart Universal SYBR Green Master Mix (Cat No. 04913850001; Roche, Basel, Switzerland), qPCR was performed. Using ∆∆Ct method with β-actin (Forward: GAGGTATCCTGACCCTGAAGTA,

(20) Renal protective effects of helix B surface polypeptide in rats with puromycin aminonucleoside nephropathyRenal FailureDecember 31, 2024Ting Chen, Xiao-ye Shen, Hui-min Liang, Hui Shi, Li Yuanin Table 1. Real-time PCR was carried out using the FastStart Universal SYBR Green Master (Cat. No. 04913850001; Roche, Mannheim, Germany) fluorescence dye on a CFX96TM PCR cycler (Bio-Rad, CA, USA). The reaction

Be the First to Write a Review!