FCHO1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemFCHO1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-97726
Gene NameFCH domain only 1
Quantity10 µM
Specieshuman
NCBI Full Gene NameFCH and mu domain containing endocytic adaptor 1
NCBI Gene AliasesIMD76
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) FCH domain only 1 (FCHo1), a potential new biomarker for lung cancerCancer gene therapyJuly 1, 2022Park S, Lee AY, Cho KC, Jung JH, Hong SH, Kim S, Kim KP, Park J, Cho MH.

(2) DASC, a sensitive classifier for measuring discrete early stages in clathrin-mediated endocytosiseLifeApril 30, 2020Wang X, Chen Z, Mettlen M, Noh J, Schmid SL, Danuser G.AAGCACUUUGACUGGUUAUU #2:AACAGUCGUGCUAGUUCCUCA Transfected construct (human),siRNA to FCHO1,Santa Cruz,Sc-97726,transfected construct (human) Transfected construct (human),siRNA to NECAP1 (stealth),Invitrogen,HSS177973,Sense

Be the First to Write a Review!

FCHO1 siRNA (h)

FCHO1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (2)

Reviews

FCHO1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map