EAF2 siRNA (h) from Santa Cruz Biotechnology, Inc. | Biocompare.com

Supplier Images

EAF2 siRNA (h)

Be the first to write a review!

Citations:

Supplier Page from
Santa Cruz Biotechnology, Inc. for
EAF2 siRNA (h)

Description

EAF2 siRNA (h)

Product Specs
ItemEAF2 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-62251
TypesiRNA/dsRNA
NCBI Gene AliasesBM040, TRAITS, U19
NCBI Full Gene NameELL associated factor 2
Specieshuman
Quantity10 µM
Gene NameELL associated factor 2

Add to Compare List

Santa Cruz Biotechnology, Inc.

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) FOXA1 modulates EAF2 regulation of AR transcriptional activity, cell proliferation, and migration in prostate cancer cellsThe ProstateJune 15, 2015Guo W, Keener AL, Jing Y, Cai L, Ai J, Zhang J, Fisher AL, Fu G, Wang Z.sequences of siRNA were listed as follows: siEAF2.1 is siRNA pool against EAF2 purchased from Santa Cruz (sc-62251). siEAF2.2: AAGGTTCAACTCCACCAGTAA was purchased from Qiagen (SI000375627). siEAF2: AAACAGUUACUGGUGGAGUUGAACCUU

(2) Identification of a genetic interaction between the tumor suppressor EAF2 and the retinoblastoma protein (Rb) signaling pathway in C. elegans and prostate cancer cellsBiochemical and biophysical research communicationsMay 2, 2014Cai L, Wang D, Fisher AL, Wang Z.Briefly, LNCaP cells were transfected with control (Santa Cruz, sc-37007) or EAF2 siRNA (Santa Cruz, sc-62251) in the presence of 1nM methyltrienolone (R1881) (Perkin Elmer, CAS# 965-93-5) for 48h. These cells

Be the First to Write a Review!