Negative shRNA control in pRS Vector from OriGene Technologies

Product Specs
ItemNegative shRNA control in pRS Vector
CompanyOriGene Technologies
Price $270.00Supplier Page View Company Product Page
Catalog NumberTR30003
Quantity5 µg
TypeshRNA Plasmids

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) Heparanase regulates EMT and cancer stem cell properties in prostate tumorsFrontiers in oncologyJanuary 1, 2022Masola V, Franchi M, Zaza G, Atsina FM, Gambaro G, Onisto M.described earlier (31, 32). As a negative control, we used an shRNA pRS non-effective GFP plasmid (TR30003). DU145 and PC3 cells were seeded in six-well plates and when they reached 70%–80% of confluence, they

(2) p38 MAPK activation through B7-H3-mediated DUSP10 repression promotes chemoresistanceScientific reportsApril 9, 2019Flem-Karlsen K, Tekle C, Øyjord T, Flørenes VA, Mælandsmo GM, Fodstad Ø, Nunes-Xavier CE.(shB7-H3; sequence shRNA‐2, 5′-TCGTGTGCTGGAGAAAGATCAAACAGAGC‐3′) and control plasmid pRS nontarget TR30003 (shSCR; sequence 5′‐GCACTACCAGAGCTAACTCAGATAGTACT‐3′) (both from Origene Technologies). All cells were grown

(3) A CCR4 antagonist reverses the tumor-promoting microenvironment of renal cancerThe Journal of clinical investigationMarch 1, 2017Berlato C, Khan MN, Schioppa T, Thompson R, Maniati E, Montfort A, Jangani M, Canosa M, Kulbe H, Hagemann UB, et al.provided to target human (TR314127) and mouse (TR500386) CCR4. A nonspecific shRNA sequence (shGFP, TR30003) and empty pRS vector (TR20003) served as controls. Phoenix packaging cell line was transfected overnight

(4) RBM10 promotes transformation-associated processes in small cell lung cancer and is directly regulated by RBM5PloS oneJanuary 1, 2017Loiselle JJ, Roy JG, Sutherland LC.humidified chamber for 24 hours. Half of the cells were transfected with a control shRNA vector “Hush 300” (TR30003, Origene Technologies, Inc, Rockville, U.S.A) and the other half with a 50:50 shRNA mix of “Hush 29”

(5) SIRT7 promotes genome integrity and modulates non-homologous end joining DNA repairThe EMBO journalJuly 15, 2016Vazquez BN, Thackray JK, Simonet NG, Kane-Goldsmith N, Martinez-Redondo P, Nguyen T, Bunting S, Vaquero A, Tischfield JA, Serrano L.between passages 1 and 3. Plasmids and cell lines shRNA‐SirT7‐pRS (TI306753, TI306755), shRNA‐Scr‐pRS (TR30003, TR30012), pCMV6‐SirT7‐GFP (RG205658), and pCMV6‐H3.1 (RC214879) plasmids were obtained from Origene.

(6) Nm23H1 mediates tumor invasion in esophageal squamous cell carcinoma by regulation of CLDN1 through the AKT signalingOncogenesisJuly 4, 2016Kuo KT, Chen CL, Chou TY, Yeh CT, Lee WH, Wang LS.(# TR20003; cell line Vec-shRNA; Origene, Rockville, MD, USA), pRS-short hairpin (sh) GFP (Origene # TR30003; encoding a non-effective 29-mer shGFP cassette as a negative control; cell line GFP-shRNA), or with

(7) Peroxiredoxin 6 (Prdx6) supports NADPH oxidase1 (Nox1)-based superoxide generation and cell migrationFree radical biology & medicineJuly 1, 2016Kwon J, Wang A, Burke DJ, Boudreau HE, Lekstrom KJ, Korzeniowska A, Sugamata R, Kim YS, Yi L, Ersoy I, et al.p22phox (no. 449) were described previously [9]. pRS vector (#TR20003), GFP-specific shRNA vector (#TR30003), and four human Prx6-targeted pRS shRNA expression vectors (#TR310191) were obtained from OriGene (OriGene

(8) Mic60/mitofilin overexpression alters mitochondrial dynamics and attenuates vulnerability of dopaminergic cells to dopamine and rotenoneNeurobiology of diseaseJuly 1, 2016Van Laar VS, Berman SB, Hastings TG.negative control TR20003 (EV-shRNA), the non-functional GFP-targeted shRNA construct negative control TR30003 (GFP-shRNA), and the functional human Mic60 targeted shRNA constructs, TI348605 (Mic60’05), TI348607

(9) A novel miR-371a-5p-mediated pathway, leading to BAG3 upregulation in cardiomyocytes in response to epinephrine, is lost in Takotsubo cardiomyopathyCell death & diseaseOctober 29, 2015d'Avenia M, Citro R, De Marco M, Veronese A, Rosati A, Visone R, Leptidis S, Philippen L, Vitale G, Cavallo A, et al.ID=9531; Origene Cat.Nr.TR314524) or HuSH 29-mer shRNA non-effective expression (No target; Origene Cat.Nr.TR30003) for 72 h. RNA-binding protein immunoprecipitation assay RIP assay was performed with Magna RIP kit

(10) TNF Apoptosis Protection Fraction (TAPF) prevents apoptosis induced by TNF, but not by Fas or TRAIL, via NF-κB-induced increase in cFLIPCytokineOctober 1, 2015Seol JY, Mihich E, Berleth ES.

(11) RIAM (Rap1-interacting adaptor molecule) regulates complement-dependent phagocytosisCellular and molecular life sciences : CMLSJuly 1, 2013Medraño-Fernandez I, Reyes R, Olazabal I, Rodriguez E, Sanchez-Madrid F, Boussiotis VA, Reche PA, Cabañas C, Lafuente EM.transduced with the retroviral plasmid pRS-TI326599 containing a RIAM specific shRNA sequence or with pRS-TR30003, a plasmid containing a GFP shRNA as negative control (Hush™ shRNA Plasmid Panels 29-mer, OriGene Technologies)

(12) FGFR4 Role in Epithelial-Mesenchymal Transition and Its Therapeutic Value in Colorectal CancerPLoS ONEMay 16, 2013Alberto Peláez-García, Rodrigo Barderas, Sofía Torres, Pablo Hernández-Varas, Joaquín Teixidó, Félix Bonilla, Antonio Garcia de Herreros, J. Ignacio CasalTI378643 and TI378644) for FGFR4 (NM_022963) and a control shRNA non-effective against any human sequence (TR30003) were from Origene. Stably-transfected cells were obtained by retroviral infection. Briefly, HEK293FT

(13) Deacetylation of FOXO3 by SIRT1 or SIRT2 leads to Skp2-mediated FOXO3 ubiquitination and degradationOncogeneMarch 22, 2012Wang F, Chan CH, Chen K, Guan X, Lin HK, Tong Q.for transient knockdown of SIRT1 in HEK293T cells and DU145 cells. pRD-shGFP non-effective (Origene, TR30003) was used as control. Immunoprecipitation and immunoblot analysis Cells were lysed with lysis buffer

(14) Mesothelin confers pancreatic cancer cell resistance to TNF-α-induced apoptosis through Akt/PI3K/NF-κB activation and IL-6/Mcl-1 overexpressionMolecular CancerDecember 1, 2011Uddalak Bharadwaj, Christian Marin-Muller, Min Li, Changyi Chen, Qizhi Yao(TR311377, Origene, Rockville, MD) and 29-mer shRNA encoding non-effective expression plasmid against GFP (TR30003) were used. MIA-MSLN and MIA-V cells were transfected with MSLN/IL-6 specific siRNA using Lipofectamine

(15) B7-H3 Silencing Increases Paclitaxel Sensitivity by Abrogating Jak2/Stat3 PhosphorylationMolecular Cancer TherapeuticsJune 1, 2011Hao Liu et al.cell lines HuSH 29mer shRNA constructs against B7-H3 (shB7-H3) and control plasmid pRS non-targeted TR30003 (TR33) were purchased from Origene Technologies, Inc (Rockville, MD) The sequences of shB 7-H3 were

(16) Posttranscriptional suppression of proto-oncogene c-fms expression by vigilin in breast cancerMolecular and cellular biologyJanuary 1, 2011Woo HH, Yi X, Lamb T, Menzl I, Baker T, Shapiro DJ, Chambers SK.respectively, of human HuR (GenBank NM_001419). An shRNA containing a noneffective 29-nt GFP sequence (TR30003, Origene) was used as a negative control [(⫺) CTRL]. For RNAi, 5 ⫻ 106 cells were transfected with 10 ␮g

(17) Human RecQL4 helicase plays critical roles in prostate carcinogenesisCancer researchNovember 15, 2010Su Y, Meador JA, Calaf GM, Proietti De-Santis L, Zhao Y, Bohr VA, Balajee AS.monitored by western blot using either C-terminal or N-terminal antibody. Empty (TR20002), scrambled (TR30003) and 4 different RecQL4 specific shRNA vectors (TI339521, TI339522, TI339523 and TI339524) were procured

(18) Methionine sulfoxide reductase A down-regulation in human breast cancer cells results in a more aggressive phenotypeProceedings of the National Academy of SciencesOctober 26, 2010Antonella De Luca, Fabio Sanna, Michele Sallese, Carmen Ruggiero, Mauro Grossi, Paolo Sacchetta, Cosmo Rossi, Vincenzo De Laurenzi, Carmine Di Ilio, Bartolo Favalorousing Lipofectamine 2000 (Invitrogen) with the pRS vector (Origene # TR20003), pRS-shGFP (Origene # TR30003, encoding noneffective 29-mer shGFP cassette as a negative control), or with speciﬁc MsrAdirected 29-mer

(19) Indole-3-carbinol triggers aryl hydrocarbon receptor-dependent estrogen receptor (ER)alpha protein degradation in breast cancer cells disrupting an ERalpha-GATA3 transcriptional cross-regulatory loopMolecular biology of the cellApril 1, 2010Marconett CN, Sundar SN, Poindexter KM, Stueve TR, Bjeldanes LF, Firestone GL.Short-hairpin RNA plasmids directed against AhR (TI378261) or against green fluorescent protein (GFP) (TR30003) were obtained from Origene Technologies (Rockville, MD). Human cytomegalovirus (CMV)-GATA3 overexpression

(20) Transcriptional coactivator HCF-1 couples the histone chaperone Asf1b to HSV-1 DNA replication componentsProceedings of the National Academy of SciencesFebruary 9, 2010Hua Peng, Mauricio L. Nogueira, Jodi L. Vogel, Thomas M. KristieStation. Asf1b Depletions. HeLa cells were transfected with 3 ug control GFP or Asf1b specific shRNAs (Origene, TR30003 and TR317316, respectively) using Fugene 6 (Roche). Viral infections and coimmunoprecipitations were

Be the First to Write a Review!

Negative shRNA control in pRS Vector from OriGene Technologies

Description

OriGene Technologies

Citations (24)

Reviews

Negative shRNA control in pRS Vector from OriGene Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map