Rsk-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemRsk-1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29475
Gene Nameribosomal protein S6 kinase, 90kDa, polypeptide 1
Quantity10 µM
Specieshuman
NCBI Full Gene Nameribosomal protein S6 kinase A1
NCBI Gene AliasesHU-1, MAPKAPK1, MAPKAPK1A, RSK, RSK1, p90Rsk
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) MEK reduces cancer-specific PpIX accumulation through the RSK-ABCB1 and HIF-1α-FECH axesScientific reportsDecember 17, 2020Chelakkot VS, Liu K, Yoshioka E, Saha S, Xu D, Licursi M, Dorward A, Hirasawa K.

(2) p90RSK Activation Promotes Epithelial-Mesenchymal Transition in Cisplatin-Treated Triple-Negative Breast Cancer CellsJournal of Bacteriology and VirologyJanuary 1, 2019Yujin Jin, Kyung-Sun Heosequence Snail CCCCAATCGGAAGCCTACT GCTGGAAGGTAAACTCTGGATTAGA Twist GGAGTCCGCAGTCTTACGAG TCTGGAGGACCTGGTAGAGG E-Cadherin AATTCCTGCCATTCTGGGGA TCTTCTCCGCCTCCTTCTTC N-cadherin TGAGCCTGAAGCCAACCTTA AGGTCCCCTGGAGTTTTCTG GAPDH GCACCGTCAAGGGCTGAGAAC TGGTGAAGACGCCAGTGGA p90RSK knockdown To knockdown p90RSK in vitro, specific short interference RNA (siRNA) was used (#SC-29475, Santa Cruz Biotechnology, Santa Cruz, CA, USA). A siRNA that does not match any known human coding

(3) RSK2 activity mediates glioblastoma invasiveness and is a potential target for new therapeuticsOncotargetNovember 29, 2016Sulzmaier FJ, Young-Robbins S, Jiang P, Geerts D, Prechtl AM, Matter ML, Kesari S, Ramos JW.

(4) Regulatory effects of programmed cell death 4 (PDCD4) protein in interferon (IFN)-stimulated gene expression and generation of type I IFN responsesMolecular and cellular biologyJuly 1, 2012Kroczynska B, Sharma B, Eklund EA, Fish EN, Platanias LC.

(5) Proteinase-activated receptors induce interleukin-8 expression by intestinal epithelial cells through ERK/RSK90 activation and histone acetylationFASEB journal : official publication of the Federation of American Societies for Experimental BiologyJune 1, 2010Wang H, Moreau F, Hirota CL, MacNaughton WK.

(6) Hsp27 promotes insulin-like growth factor-I survival signaling in prostate cancer via p90Rsk-dependent phosphorylation and inactivation of BADCancer researchMarch 15, 2010Zoubeidi A, Zardan A, Wiedmann RM, Locke J, Beraldi E, Fazli L, Gleave ME.

(7) Dissecting the roles of DR4, DR5 and c-FLIP in the regulation of geranylgeranyltransferase I inhibition-mediated augmentation of TRAIL-induced apoptosisMolecular cancerJanuary 29, 2010Chen S, Fu L, Raja SM, Yue P, Khuri FR, Sun SY.5'-AACGAGATTCTGAGCAACGCA-3' (954-974) and 5'-AATGAGATCGATGTGGTCAGA-3' (1239-1259), respectively. RhoB siRNA (sc-29475) was purchased from Santa Cruz Biotechnology. Transfection of these siRNA duplexes were conducted in

Be the First to Write a Review!

Rsk-1 siRNA (h)

Rsk-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (7)

Reviews

Rsk-1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map