ASK 1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Product Specs
ItemASK 1 siRNA (h)
CompanySanta Cruz Biotechnology, Inc.
Price $293.00Supplier Page View Company Product Page
Catalog Numbersc-29748
Gene Namemitogen-activated protein kinase kinase kinase 5
Quantity10 µM
Specieshuman
NCBI Full Gene Namemitogen-activated protein kinase kinase kinase 5
NCBI Gene AliasesASK1, MAPKKK5, MEKK5
TypesiRNA/dsRNA

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Reactive oxygen species induce HNF-4α expression via the ASK1-CREB pathway, promoting ChREBP expression and lipogenesis in hepatocytesLife sciencesDecember 1, 2022Seo E, Nam H, Jun HS.

(2) DAB2IP predicts treatment response and prognosis of ESCC patients and modulates its radiosensitivity through enhancing IR-induced activation of the ASK1-JNK pathwayCancer cell internationalMarch 5, 2022Tong Z, Fang W, Xu M, Xia Y, Wang R, Li Y, Zha T, Xiao L, Pan S, Chai H, et al.

(3) MTA2 silencing attenuates the metastatic potential of cervical cancer cells by inhibiting AP1-mediated MMP12 expression via the ASK1/MEK3/p38/YB1 axisCell death & diseaseMay 6, 2021Lin CL, Ying TH, Yang SF, Chiou HL, Chen YS, Kao SH, Hsieh YH.

(4) Regulation of Cellular Stress Signaling in Bladder IschemiaResearch and reports in urologyJanuary 1, 2020Yang JH, Li Y, Azad R, Azadzoi K.

(5) TGF-β downregulation-induced cancer cell death is finely regulated by the SAPK signaling cascadeExperimental & molecular medicineDecember 6, 2018Han Z, Kang D, Joo Y, Lee J, Oh GH, Choi S, Ko S, Je S, Choi HJ, Song JJ.

(6) miR-106a Increases Granulosa Cell Viability and Is Downregulated in Women With Diminished Ovarian ReserveThe Journal of clinical endocrinology and metabolismJune 1, 2018Hong L, Peng S, Li Y, Fang Y, Wang Q, Klausen C, Yin C, Wang S, Leung PCK, Yang X.

(7) Knockdown of MiR-20a Enhances Sensitivity of Colorectal Cancer Cells to Cisplatin by Increasing ASK1 ExpressionCellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacologyJanuary 1, 2018Zhang L, He L, Zhang H, Chen Y.

(8) SOCS-1 rescues IL-1β-mediated suppression of epithelial sodium channel in mouse lung epithelial cells via ASK-1OncotargetMay 17, 2016Galam L, Soundararajan R, Breitzig M, Rajan A, Yeruva RR, Czachor A, Harris F, Lockey RF, Kolliputi N.(sense sequence, UUAUGCCGAUCGCGUCACAUU) was obtained from Santa Cruz and ASK-1 shRNA (catalog number sc-29748) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). MLE-12 cells were transfected with either

(9) Preclinical Evaluation of Liposomal C8 Ceramide as a Potent anti-Hepatocellular Carcinoma AgentPloS oneJanuary 1, 2016Lv H, Zhang Z, Wu X, Wang Y, Li C, Gong W, Gui L, Wang X.

(10) Anti-Proliferation Activity of Fucoidan in MKN45 Gastric Cancer Cells and Downregulation of Phosphorylated ASK1, a Cell Cycle-Regulated KinaseYonago acta medicaMarch 1, 2015Yoshimoto M, Higaki K, Nanba E, Ikeguchi M.

(11) Apoptosis signal-regulating kinase 1 promotes Ochratoxin A-induced renal cytotoxicityScientific reportsJanuary 28, 2015Liang R, Shen XL, Zhang B, Li Y, Xu W, Zhao C, Luo Y, Huang K.

(12) Atmospheric pressure gas plasma-induced colorectal cancer cell death is mediated by Nox2-ASK1 apoptosis pathways and oxidative stress is mitigated by Srx-Nrf2 anti-oxidant systemBiochimica et biophysica actaDecember 1, 2014Ishaq M, Evans MD, Ostrikov KK.

(13) Atmospheric gas plasma-induced ROS production activates TNF-ASK1 pathway for the induction of melanoma cancer cell apoptosisMolecular biology of the cellMay 1, 2014Ishaq M, Kumar S, Varinli H, Han ZJ, Rider AE, Evans MD, Murphy AB, Ostrikov K.∼70% confluence with antibiotic-free media were transfected with the ASK1 short hairpin RNA (shRNA; sc-29748; Santa Cruz Biotechnology, Santa Cruz, CA) and negative control shRNA expression vector by Lipofectamine

(14) Apoptosis signal-regulating kinase 1 is involved in WISP-1-promoted cell motility in human oral squamous cell carcinoma cellsPloS oneJanuary 1, 2013Chuang JY, Chang AC, Chiang IP, Tsai MH, Tang CH.

(15) Ursolic acid induces ER stress response to activate ASK1-JNK signaling and induce apoptosis in human bladder cancer T24 cellsCellular signallingJanuary 1, 2013Zheng QY, Li PP, Jin FS, Yao C, Zhang GH, Zang T, Ai X.

(16) Apoptosis signal-regulating kinase 1 is mediated in TNF-α-induced CCL2 expression in human synovial fibroblastsJournal of cellular biochemistryNovember 1, 2012Tsou HK, Chen HT, Chang CH, Yang WY, Tang CH.

(17) FPipTB, a benzimidazole derivative, induces chondrosarcoma cell apoptosis via endoplasmic reticulum stress and apoptosis signal-regulating kinase 1Molecular carcinogenesisApril 1, 2012Liu JF, Chang CS, Fong YC, Kuo SC, Tang CH.

(18) TNF-α response of vascular endothelial and vascular smooth muscle cells involve differential utilization of ASK1 kinase and p73Cell death and differentiationFebruary 1, 2012Rastogi S, Rizwani W, Joshi B, Kunigal S, Chellappan SP.percentage of BrdU-positive cells was graphically represented. si RNA transfections ASK1 (cat no. sc-29748), E2F1 (cat no. sc-29297), p53 (cat no. sc-29435), p73 (cat no.sc-36167), Rb (cat no. sc-29468) and

(19) CTGF increases IL-6 expression in human synovial fibroblasts through integrin-dependent signaling pathwayPloS oneJanuary 1, 2012Liu SC, Hsu CJ, Chen HT, Tsou HK, Chuang SM, Tang CH.

(20) MEKK1/MEKK4 are responsible for TRAIL-induced JNK/p38 phosphorylationOncology reportsFebruary 1, 2011Sun BK, Kim JH, Nguyen HN, Oh S, Kim SY, Choi S, Choi HJ, Lee YJ, Song JJ.

Be the First to Write a Review!

ASK 1 siRNA (h)

ASK 1 siRNA (h) from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (24)

Reviews

ASK 1 siRNA (h) from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map