ISGF-3γ p48 siRNA (h) from Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

(1) IFN-γ Induces IL-15 Trans-Presentation by Epithelial Cells via IRF1Journal of immunology (Baltimore, Md. : 1950)January 15, 2022Kim TS, Rha MS, Shin EC.

(2) Disrupting interferon-alpha and NF-kappaB crosstalk suppresses IFITM1 expression attenuating triple-negative breast cancer progressionCancer lettersAugust 28, 2021Provance OK, Geanes ES, Lui AJ, Roy A, Holloran SM, Gunewardena S, Hagan CR, Weir S, Lewis-Wambi J.(Santa Cruz Biotechnology: sc-44123), STAT2 (Santa Cruz Biotechnology: sc-29492) and IRF9 (Santa Cruz Biotechnology: sc-38013) and harvested 48 hours post transfection for western blot analysis. MDA-MB-468 and MDA-MB-157 cells

(4) IFN-alpha induces transcription of hypoxia-inducible factor-1alpha to inhibit proliferation of human endothelial cellsJournal of immunology (Baltimore, Md. : 1950)July 15, 2008Gerber SA, Pober JS.IRF9 was accomplished using siRNA from Santa Cruz Biotechnology (sequence proprietary, catalog no. sc-38013), and specificity was confirmed using two separate sequences from Qiagen (target sequence: CAACAAGAGTTCTGAATTTAA,

ISGF-3γ p48 siRNA (h)