siRNA Related Product from OriGene Technologies

Product Specs
ItemsiRNA Related Product
CompanyOriGene Technologies
Price $130.00Supplier Page View Company Product Page
Catalog NumberSR30004
Quantity2 nmol
TypesiRNA Oligo Duplexes

Add to Compare List

OriGene Technologies

9620 Medical Center Drive # 200

Rockville, Maryland 20850

United States

Phone: 1-888-267-4436 (U.S. only) / 301-340-3188
301-340-9254

Company Profile

Website: http://www.origene.com

(1) Transcriptomic Profiling of the Effects of DDR1 in Breast and Ovarian Cancer to Understand the Association Between DDR1 Expression and Patient SurvivalGenes (Basel)June 30, 2026Khalid Alshammari, Suha Deen, Ian O. Ellis, Emad A. Rakha, Andrew R. Green, Stewart G. Martin, Sarah J. Storr(Thermo-Fisher, MA, USA) and 11.2nM siRNA (DDR1: Origene, MD, USA, SR319533A) or negative control siRNA (OriGene SR30004). Cell transfection occurred over 24 h, and knockdown was assessed at 24, 48, and 72 h post-transfection. Gene knockdown

(2) Enhanced expression of ADAMTS1 in ovarian carcinomas: loss of ADAMTS1 expression instigates cellular reprogramming of extracellular matrix ensuing altered plasticity, augmented migration and attenuated adhesionJ Biomed SciJune 22, 2026Ruth M. Escalona, Dylan King, Noor A. Lokman, Martin K. Oehler, Carmela Ricciardelli, George Kannourakis, Nuzhat Ahmedcell lines. A Universal nontargeting siRNA duplex was used as a Control (C) (OriGene Technologies, SR30004, MD, USA) in these experiments. To avoid off-target effects, the lowest ADAMTS1 siRNA concentrations

(3) G3BP1 is a SWI/SNF-bound regulator of transcription that modulates activation of STATsBiosci RepMay 6, 2026Natalia Papadopoulos, Niki Sarri, Johan Lennartsson, Carl-Henrik HeldinTrilencer-27 G3BP siRNA (#SR, OriGene Technologies, U.S.A.) or 20 nM scrambled negative control siRNA (#SR30004, OriGene Technologies, U.S.A.), using SilentFect reagent (Bio-Rad), and incubated for 72 to 96 h at

(4) A degrader of HER2 and EGFR abolishes p95HER2 and shows robust antitumor efficacy in HER2-positive breast cancerScientific reportsApril 20, 2026Yang L, Bhattacharya A, Li Y, Peterson D, Zhang Y.sequences are as follows: rCrGrUrUrArArUrCrGrCrGrUrArUrArArUrArCrGrCrGrUA T (scramble siRNA, Cat # SR30004), and rUrGrUrArArUrUrUrUrGrArCrArUrGrGrUrUrGrGrGrArCrUrCrUr U (HER2 siRNA, Cat # SR320064A). Gene transfection SW620

(5) Functional roles of NR4A transcription factors in GnRH regulation of gonadotropin gene expression and secretion in rat primary pituitary cellsJournal of Reproduction and DevelopmentApril 15, 2026Ryota TERASHIMA, Yuta TOMIYAMA, Shiro KURUSU, Mitsumori KAWAMINAMI#SR513154C), and Nr4a3 (siNr4a3, #SR500165A) and a universal scrambled negative control siRNA duplex (siCont, #SR30004) were purchased from OriGene Technologies (Rockville, MD, USA). Nr4a family genes were knocked down

(6) Fibro-adipogenic progenitor cells from murine SMA muscles are intrinsically adipogenicProc Natl Acad Sci U S AMarch 31, 2026Yangyi E. Luo, Zoe Abe-Teh, Tarek Alsaghir, Katie D. Heiden, Kari B. Basso, Elisabeth R. BartonsiRNAs were purchased from Origene (SR408281). A universal scrambled negative control siRNA duplex (SR30004) was used in the control groups. After primary FAPs achieved 80% confluency, cells were transfected

(7) Regulation of PKM2 expression and function by GLIS3 during metabolic reprogramming in polycystic kidneysExperimental & Molecular MedicineMarch 13, 2026Justin B. Collier, Hong Soon Kang, Sara A. Grimm, Tanushree Mukherjee, Chitrangda Srivastava, Anton M. Jettenregions of Pkm2 were pooled together (SR416841; Origene). A scrambled siRNA was used as negative control (SR30004; Origene). A total of 2 days before spheroid culture, RECs were transfected with each duplex at 10 nM

(8) Occludin modulates HIV and ischaemic stroke response via the mitochondrial antiviral signalling pathwayBrain : a journal of neurologyMarch 5, 2026Torices S, Moreno T, Osborne OM, Ramaswamy S, Naranjo O, Teglas T, Park M, Sun E, Toborek M.Supplementary Table 2. Trilencer-27-universal scrambled (SCR) silencer siRNA duplex (OriGene, Cat. No. SR30004) was used as a negative control. For Ocln overexpression, cells were transfected with the PCMV3-OCLN

(9) ADAM17-induced shedding of glypican-1 as a mechanism of impaired endothelial shear stress mechanotransductionAmerican Journal of Physiology-Cell PhysiologyMarch 1, 2026Marc A. Augenreich, Larissa Ferreira-Santos, Gavin Power, Francisco I. Ramirez-Perez, Juan D. Gonzalez-Vallejo, Morgan B. Williams, Natnicha Imkaew, Min Jeong Cho, Andrew A. Wheeler, Camila Manrique-Acevedo, et al.Invitrogen, 13778150) with an siRNA against glypican-1 (SR301881CL, OriGene) or a scrambled control (SR30004, OriGene) and exposed to static or shear stress (15 dynes/cm2) conditions for 24 hr using the ibidi

(10) Pan-cancer N-glycoproteomic atlas of patient-derived xenografts uncovers FAT2 as an actionable surface targetCell Reports MedicineFebruary 17, 2026Meinusha Govindarajan, Salvador Mejia-Guerrero, Shawn C. Chafe, Shahbaz Khan, Wei Shi, Matthew Waas, Martin A. Rossotti, Amanda Khoo, Lydia Y. Liu, Vladimir Ignatchenko, et al.Laboratory,RRID:IMSR_JAX:005557 ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, Scramble siRNA 5′- CGUUAAUCGCGUAUAAUACGCGUAT -3′,Origene,Cat# SR30004 FAT2 siRNA-A 5′- CCAAUGCUCAGAUCACAUAUUCUCT -3′,Origene,Cat# SR301535 FAT2 siRNA-B 5′- GGAGAGUACAACAUCCUAACGAUCA

(11) Targeting PLK1 Reduces MMP10 to Enhance Radiosensitivity in HPV— Head and Neck CancerClinical Cancer ResearchJanuary 16, 2026Julianna Korns, Maria A. Lehn, Shreya Shyamsunder, Mario Medvedovic, Stephanie M. Bryant, Mathieu G. Sertorio, Maya Ridinger, Trisha M. Wise-Draper, Vinita Takiar(Origene, Cat# TT320001). The siRNA mixture or scrambled negative control (0.1nM NC, Origene, Cat# SR30004) was incubated at room temperature for 15 minutes then added dropwise to each well. RNA was collected

(12) Targeting PLK1 Reduces MMP10 to Enhance Radiosensitivity in HPV− Head and Neck CancerClin Cancer ResJanuary 16, 2026Julianna Korns, Maria A. Lehn, Shreya Shyamsunder, Mario Medvedovic, Stephanie M. Bryant, Mathieu G. Sertorio, Maya Ridinger, Trisha M. Wise-Draper, Vinita Takiar(Origene, Cat# TT320001). The siRNA mixture or scrambled negative control (0.1nM NC, Origene, Cat# SR30004) was incubated at room temperature for 15 minutes then added dropwise to each well. RNA was collected

(13) Bacterial Toxin Exploits Host Membrane Phospholipid as a Receptor for Binding, Entry, and CytopathogenicityMolecular MicrobiologyJanuary 3, 2026Alejandra M. Kirkpatrick, Thirumalai R. Kannantransfected with siRNA against AnxA2 (Ambion, 4390824) or negative control (scrambled siRNA; Origene, SR30004) using Lipofectamine RNAiMAX transfection reagent (ThermoFisher) according to the manufacturer instructions.

(14) KLF13-Mediated CES2 Upregulation via p300-Dependent Acetylation Sensitizes Gastric Cancer Cells to IrinotecaniScienceDecember 19, 2025Hai-bin Zhang, Ren-hao Hu, Ke-hui Zhang, Xi-mao Cui, Shun Zhangsequences,N/A siRNA against KLF13 (SR309879),Origene,Cat# SR309879 siRNA against Control (Si-NC),Origene,Cat# SR30004 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, pFLAG-CMV-6c vector,Sigma-Aldrich,Cat#E2150 pGL4.10[luc2] vector

(15) Targeting ATR offers multifaceted treatment strategies involving RAD51-mediated compensatory DNA repair in bladder cancerJournal of Experimental & Clinical Cancer ResearchDecember 12, 2025Julia Pannhausen, Ahmed A. Chughtai, Cem-Louis Yüce, Michael K. Melzer, Yanchun Ma, Lancelot Seillier, Emiel P. C. van der Vorst, Geoffroy Andrieux, Julia Wirtz, Sophie Leypold, et al.and 12 µL ATR-specific siRNA (SR319441, 5 µM, OriGene Technologies) or non-targeting control siRNA (SR30004, 5 µM, OriGene Technologies) resulting in a final siRNA concentration of 30 nM. Cells were harvested

(16) Very long-chain fatty acids drive 1-deoxySphingolipid toxicityNature CommunicationsNovember 26, 2025Adam Majcher, Gergely Karsai, Elkhan Yusifov, Martina Schaettin, Ermanno Malagola, Peter Horvath, Jinmei Li, Sofía Rodriguez-Gallardo, Kuniyoshi Shimizu, Gai Zhibo, et al.(knockdown) ELOVL1 expression. ELOVL1 targeting siRNA or non-coding negative control Scramble (Scr, SR30004, OriGene) siRNAs were diluted to a final concentration of 10 nM or 20 nM in reduced-serum media (Opti-MEM,

(17) Loss of TET2 activity limits the ability of vitamin C to activate DNA demethylation in human HAP1 cellsEpigenetics & ChromatinNovember 24, 2025Maciej Gawronski, Marta Starczak, Aleksandra Wasilow, Tomasz Dziaman, Ryszard Olinski, Daniel Gackowskianti-TET2 siRNA duplexes (cat. No.: SR30002), Universal scrambled negative control siRNA duplex (cat. no.: SR30004) as well as siTran 2.0 transfection reagent (cat. no. TT320001) were bought from OriGene. All siRNA

(18) PANK2-mediated de novo CoA synthesis is required for metabolic switching to fatty acid oxidationbioRxivNovember 20, 2025Sandra M. Nordlie, Robert Schafer, Adam Rauckhorst, Ana M. Santos-Exposito, Andres Prieto-Rodriguez, Bryce A Wilson, Idil A. Evans, Una Hadziamehtovic, Frances Nowlen, Carlos Santos-Ocaña, et al.Transfections followed the Lipofectamine RNAiMAX (ThermoFisher) protocol with control scramble siRNA (Origene, SR30004), or human siRNA oligo duplex against either PANK2 (Origene, SR325087B, Sequence: 5’GUAUUUUUCUAAGUCAUCAAGAUAA3’),

(19) RBM39 Contributes to MGMT Maintenance in Response to Temozolomide-Induced DNA DamageCancers (Basel)November 8, 2025Vahid Khalaj, Jack T. Adams, Solmaz AghaAmiri, Servando Hernandez Vargas, Tyler M. Bateman, Sukhen C. Ghosh, Majid Momeny, Ali Azhdarinia105 cells/well) and transfected with siRNA A or a universal scrambled negative control siRNA duplex (SR30004, OriGene). Since the most significant reduction in MGMT expression was observed 72 h after indisulam

(20) Reprogramming oncogenic mitochondria in pancreatic adenocarcinoma through BRD4 inhibition leads to programmed cell deathThe Journal of Pharmacology and Experimental TherapeuticsNovember 1, 2025Chun Cai, Michael W. Spinrad, Lauren C. Gattie, Rui Wang, Mohammad Amir Afjal, Jun Yang, Nour Yadak, David Shibata, Wei Li, Amandeep Bajwa, et al.siRNA (Trilencer-27 Universal Scrambled Negative Control siRNA Duplex) served as a negative control (#SR30004). Panc1 cells were seeded in 6-well plates (4 × 105/well) and cultured overnight. The siRNAs were transfected

Be the First to Write a Review!

siRNA Related Product from OriGene Technologies

Description

OriGene Technologies

Citations (366)

Reviews

siRNA Related Product from OriGene Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map