SignalSilence ® Rictor siRNA I from Cell Signaling Technology

Product Specs
ItemSignalSilence ® Rictor siRNA I
CompanyCell Signaling Technology
Price $369.00 Inquire
Catalog Number8649S
Quantity300 µl
ApplicationssiRNA
TargetRictor
ReactivityH
TypesiRNA
NCBI Gene AliasesAVO3, PIA, hAVO3
NCBI Full Gene NameRPTOR independent companion of MTOR complex 2
Research AreaPI3K / Akt Signaling

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) mTOR Regulation of N-Myc Downstream Regulated 1 (NDRG1) Phosphorylation in Clear Cell Renal Cell CarcinomaInternational Journal of Molecular SciencesMay 27, 2023Anisha Valluri, Jessica Wellman, Chelsea L. McCallister, Kathleen C. Brown, Logan Lawrence, Rebecca Russell, James Jensen, James Denvir, Monica A. Valentovic, Krista L. Denning, et al.(Dharmacon, Lafayette, CO, USA, D-001810-10-05), Rictor siRNA I (Cell Signaling Technology, Danvers, MA, USA, 8649), Rictor siRNA II (Cell Signaling Technology, 8622), and Lipofectamine RNAiMAX (Thermo Fisher Scientific,

(2) Up-regulation of Sirtuin-1/autophagy signaling in human cerebral ischemia: possible role in caspase-3 mediated apoptosisHeliyonDecember 13, 2022Sireesh Kumar Teertam, Prakash Babu Phanithithe antibodies used in this study were purchased from Cell Signaling Technology (CST, US). Sirt1 (CST#8649), Autophagy Antibody Sampler Kit (CST#4445), beta-actin (CST#8457), Anti-rabbit Ig-G-Alexa fluor-488

(3) Rictor maintains endothelial integrity under shear stressFrontiers in cell and developmental biologyJanuary 1, 2022Li H, Zhou WY, Liu YX, Xia YY, Xia CL, Pan DR, Li Z, Shi Y, Chen SL, Zhang JX.against GAPDH (60,004–1) was purchased from Proteintech. Small interfering RNA (siRNA) targeting Rictor (8649s) was purchased from Cell Signaling Technology. Actin-Tracker Red-Rhodamine (C2207s) was obtained from

(4) Quercetin modulates AMPK/SIRT1/NF-κB signaling to inhibit inflammatory/oxidative stress responses in diabetic high fat diet-induced atherosclerosis in the rat carotid arteryExperimental and therapeutic medicineDecember 1, 2020Zhang F, Feng J, Zhang J, Kang X, Qian D.h at room temperature, the membranes were incubated with primary antibodies against SIRT1 (cat. no. 8649S; 1:1,500; Cell Signaling Technology, Inc.) and β‑actin (cat. no. 3700S; 1:5,000; Cell Signaling Technology, Inc.)

(5) Lysosome Positioning Influences mTORC2 and AKT SignalingMolecular CellJuly 1, 2019Rui Jia, Juan S. BonifacinoLines HeLa,ATCC,CCL-2 HEK293T,ATCC,CRL-11268 Oligonucleotides,Oligonucleotides,Oligonucleotides siRNA targeting myrlysin,Dharmacon,J-018197-20 siRNA targeting RICTOR,Cell Signaling Technology,8649 Non-targeting siRNA,Eurofins,UGGUUUACAUGUCGACUAAUU Recombinant DNA,Recombinant DNA,Recombinant DNA GFP-mSIN1.2,Addgene,72908 LAMP1-mCherry,"Jia

(6) Decrease in membrane phospholipids unsaturation correlates with myocardial diastolic dysfunctionPLOS ONEDecember 11, 2018Tsunehisa Yamamoto et al.antibodies used in the present study were anti-phosphoAMPKα(Th172) (#4188), anti-AMPK (#2532), anti-Sirt1 (#8649), anti-SCD1 (#2794), anti-GAPDH (#2118) (Cell Signaling Technology, Danvers, MA, USA). Cell culture Primary

(7) Neddylation contributes to CD4+ T cell-mediated protective immunity against blood-stage Plasmodium infectionPLoS pathogensNovember 1, 2018Cheng Q, Liu J, Pei Y, Zhang Y, Zhou D, Pan W, Zhang J.

(8) WITHDRAWN: Targeting mTORC1/2 with OSI-027 inhibits proliferation and migration of keloid keratinocytesOncotargetJanuary 2, 2018Jun Chen, Ke Liu, Yang Liu, Xue Wang, Zhen Zhang105 cells per well, grown for 24 h, and transfected with Rictor siRNA I (Cell Signaling Technology, #8649), Rictor siRNA II (Cell Signaling Tech, #8622), or scramble control siRNA (Cell Signaling Technology,

(9) Nucleus accumbens-associated protein-1 promotes glycolysis and survival of hypoxic tumor cells via the HDAC4-HIF-1α axisOncogeneJuly 20, 2017Zhang Y, Ren YJ, Guo LC, Ji C, Hu J, Zhang HH, Xu QH, Zhu WD, Ming ZJ, Yuan YS, et al.

(10) MicroRNA-23b functions as an oncogene and activates AKT/GSK3β/β-catenin signaling by targeting ST7L in hepatocellular carcinomaCell death & diseaseMay 18, 2017Zhuang L, Wang X, Wang Z, Ma X, Han B, Zou H, Wu Z, Dong S, Qu Z, Zang Y, et al.

(11) Kainic Acid-Induced Seizures Modulate Akt (SER473) Phosphorylation in the Hippocampus of Dopamine D2 Receptor Knockout MiceJournal of Molecular NeuroscienceJanuary 1, 2013Mark Dunleavy, Giovanni Provenzano, David C. Henshall, Yuri BozziBorrelli E (2000) Neuroprotective role of dopamine against hippocampal cell death. J Neurosci 20:8643–8649 209 Busceti CL, Biagioni F, Aronica E et al (2007) Induction of the Wnt inhibitor, Dickkopf-1, is associated

(12) Reassessment of corticospinal tract regeneration in Nogo-deficient miceThe Journal of neuroscience : the official journal of the Society for NeuroscienceJuly 8, 2009Lee JK, Chan AF, Luu SM, Zhu Y, Ho C, Tessier-Lavigne M, Zheng B.Nevertheless, Lee et al. • Nogo in Corticospinal Tract Regeneration 8652 • J. Neurosci., July 8, 2009 • 29(27):8649 – 8654 devoid of any CST axons in both the white and gray matter (supplemental Fig. 1, available at

Be the First to Write a Review!