SignalSilence ® EGF Receptor siRNA II from Cell Signaling Technology

Product Specs
ItemSignalSilence ® EGF Receptor siRNA II
CompanyCell Signaling Technology
Price $369.00 Inquire
Catalog Number6482S
Quantity300 µl
TargetEGFR
NCBI Gene AliasesERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA
NCBI Full Gene Nameepidermal growth factor receptor
Research AreaRTK
ReactivityH
ApplicationssiRNA
TypesiRNA

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) HER2-mediated enhancement of Ebola virus entryPLoS pathogensOctober 1, 2020Kuroda M, Halfmann P, Kawaoka Y.(AM51331_29 and AM51331_31, Ambion), IGF-1R (AM51331_110754 and 4392420_s223917, Ambion), EGFR (6480 and 6482, Cell signaling technology), TYRO3 (Hs_TYRO3_5 and Hs_TYRO3_6, Qiagen), MERTK (Hs_MERTK_5 and Hs_MERTK_11,

(2) Growth Factor Midkine Aggravates Pulmonary Arterial Hypertension via Surface NucleolinScientific reportsJune 25, 2020Kinoshita D, Shishido T, Takahashi T, Yokoyama M, Sugai T, Watanabe K, Tamura H, Nishiyama S, Takahashi H, Arimoto T, et al.Nucleolin (catalog No. 4390771) small interfering RNA (siRNA) was purchased from Abcam. EGFR (catalog No. 6482 s) siRNA was obtained from Cell Signaling Technology, while the negative-control (catalog No. 12935)

(3) JC Polyomavirus Entry by Clathrin-Mediated Endocytosis Is Driven by β-ArrestinJournal of virologyApril 15, 2019Mayberry CL, Soucy AN, Lajoie CR, DuShane JK, Maginnis MS.custom/AAGUGGAUGCCUUUCGGGCAUU Ambion, AP2B2, s36 Cell Signaling, SignalSilence EGF receptor siRNA II, 6482s Cell Signaling, SignalSilence control siRNA (unconjugated), 6568s Life Technologies, 465318 react to

(4) Epidermal growth factor expression as a predictor of chemotherapeutic resistance in muscle-invasive bladder cancerBMC UrologyDecember 1, 2018Ahmed M. Mansour et al.small interfering RNAs (siRNAs) targeting EGFR (SignalSilence® EGF Receptor siRNA, Cell Signaling #6482) using Lipofactamine 2000. For transfection controls, empty (Ctrl) or non-target siRNAs (siCtrl) were used. N0 5

(5) The Lipid Sulfatide Is a Novel Myelin-Associated Inhibitor of CNS Axon OutgrowthJournal of NeuroscienceApril 27, 2011Alissa M. Winzeler, Wim J. Mandemakers, Matthew Z. Sun, Melissa Stafford, Carolyn T. Phillips, Ben A. Barresgalactose:ceramide galactosyltransferase (CGT) transfers galactose to ceramide to generate ga- 6482 • J. Neurosci., April 27, 2011 • 31(17):6481– 6492 Figure 1. The sulfatide synthetic pathway. Sulfatide

(6) Cell type-specific interleukin-1beta signaling in the CNSThe Journal of neuroscience : the official journal of the Society for NeuroscienceJuly 21, 2004Srinivasan D, Yen JH, Joseph DJ, Friedman W.(Cell Signaling Technology), respectively. Bands were evaluated J. Neurosci., July 21, 2004 • 24(29):6482– 6488 • 6483 densitometrically where indicated, using NIH Image software. Each blot is representative

Be the First to Write a Review!