SignalSilence ® Cofilin siRNA I from Cell Signaling Technology

Product Specs
ItemSignalSilence ® Cofilin siRNA I
CompanyCell Signaling Technology
Price $369.00 Inquire
Catalog Number6267S
Quantity300 µl
Targetcofilin 1
NCBI Gene AliasesCFL, HEL-S-15, cofilin
NCBI Full Gene Namecofilin 1
Research AreaCytoskeletal Signaling
ReactivityH
ApplicationssiRNA
TypesiRNA

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) Programmable integrin and N-cadherin adhesive interactions modulate mechanosensing of mesenchymal stem cells by cofilin phosphorylationNat CommunNovember 11, 2022Zheng Zhang, Baoyong Sha, Lingzhu Zhao, Huan Zhang, Jinteng Feng, Cheng Zhang, Lin Sun, Meiqing Luo, Bin Gao, Hui Guo, et al.according to the manufacturer’s instructions. The siRNAs used were cofilin siRNA I (Cell Signaling, 6267) and control siRNA (Cell Signaling, 6568). Immunostaining and quantification Collected samples were

(2) The non-muscle ADF/cofilin-1 controls sarcomeric actin filament integrity and force production in striated muscle laminopathiesCell reportsAugust 24, 2021Vignier N, Chatzifrangkeskou M, Pinton L, Wioland H, Marais T, Lemaitre M, Le Dour C, Peccate C, Cardoso D, Schmitt A, et al.USA",N/A ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, List of primers,This paper,Table S3 SignalSilence® Cofilin siRNA I,Cell Signaling,Cat #6267 ,, Recombinant DNA,Recombinant DNA,Recombinant DNA ,, virus: AAV-rh10-Cfl1,"Kindly provided by Dr.

(3) Actin cables and comet tails organize mitochondrial networks in mitosisNatureMarch 1, 2021Moore AS, Coscia SM, Simpson CL, Ortega FE, Wait EC, Heddleston JM, Nirschl JJ, Obara CJ, Guedes-Dias P, Boecker CA, et al.(SantaCruz, sc-29516), WHAMM (Dharmacon, L-022415-01), Arp3 (Santa Cruz, sc-29739), Cofilin 1 (CST, 6267S), ADF (SantaCruz, sc- 43200), Gelsolin (SantaCruz, sc-37330), Spire1C (Dharmacon, CCUAGGAUAACCAGUGUAUUU),

(4) SPAG6 promotes cell proliferation and inhibits apoptosis through the PTEN/PI3K/AKT pathway in Burkitt lymphomaOncology ReportsSeptember 22, 2020Rongrong Zhang, Haiyan Zhu, Yufang Yuan, Yun Wang, Zhaofang Tianin R‑CHOP‑treated diffuse large B‑cell lymphoma: A systematic review and meta‑analysis. Sci Rep 8: 6267, 2018. 15. Rochford R and Moormann AM: Burkitt's lymphoma. Curr Top Microbiol Immunol 390: 267‑285

(5) Transient stretch induces cytoskeletal fluidization through the severing action of cofilinAmerican journal of physiology. Lung cellular and molecular physiologyMay 1, 2018Lan B, Krishnan R, Park CY, Watanabe RA, Panganiban R, Butler JP, Lu Q, Cole WC, Fredberg JJ.control (catalog no. 6568, Cell Signaling Technology) or 25 nM cofilin-targeted siRNA (catalog no. 6267, Cell Signaling Technology). The targeting sequence of this siRNA is located on exon 5 (65626886 to

(6) Regulation of TRIM24 by miR-511 modulates cell proliferation in gastric cancerJournal of Experimental & Clinical Cancer ResearchDecember 1, 2017Ziling Fang, Ling Zhang, Quan Liao, Yi Wang, Feng Yu, Miao Feng, Xiaojun Xiang, Jianping Xiong

(7) VASP activation via the Gα13/RhoA/PKA pathway mediates cucurbitacin-B-induced actin aggregation and cofilin-actin rod formationPloS oneJanuary 1, 2014Zhang YT, Xu LH, Lu Q, Liu KP, Liu PY, Ji F, Liu XM, Ouyang DY, He XH.(5′-GGACCUACAGAGGGUGAAAdTdT-3′) were designed and synthesized by RiboBio (Guangzhou, China). The siRNA duplexes (#6267) targeting cofilin was obtained from Cell Signaling Technology. The siRNA of Gα13 (#RI12255) and RhoA

Be the First to Write a Review!