GoTaq Long PCR Master Mix from Promega

Product Specs
ItemGoTaq Long PCR Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberM4021
Quantity100 reactions
Molecular Weight~105kDa

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Reduced circulating mitochondrial DNA integrity and increased DNA oxidation in preclinical and clinical pediatric obesity: an observational studyFrontiers in PediatricsJune 29, 2026Mónica M. Velásquez-Esparza, Perla Pérez-Treviño, Leticia Elizondo-Montemayor, Elena Cristina Castillo, Norma Cipatli Ayuzo Del Valle, Noemí Garcíabp was amplified according to the kit manufacturer's instructions (GoTaqLong PCR Master Mix, Promega M4021), with the addition of 200 pmol of primers (Fw: 5′-AGCGCAAGTACCCACGTAAA-3 and Rv: 5′-TGGATAAGTGGCGTTGGCTT–3)

(2) SATB1 is a targetable modulator of JAK-STAT signaling and cytokines in human Treg and Tconv cellsEMBO ReportsJune 12, 2026Saskia Kolb, Leonie Diekmann, Elizabeth E Lochert, Linda Warmuth, Julia Ritter, Gunter Schmidtke, Michael Weber, Markus Hoffmann, Markus List, Daniel Kotlarz, et al.NIR™,BioLegend,Cat#: 423106 Transposase,Illumina,Cat#: 20034197 GoTaq® Long PCR Master Mix,Promega,Cat#: M4021 NEBNext High Fidelity 2x PCR Mastermix,NEB,Cat#: M0541L Software,Software,Software Benchling,https://www.benchling.com,n/a TIDE

(3) Hypoxia/Reoxygenation-Induced Mitochondrial Reverse Electron Transfer: A Targetable Mechanism to Enhance Radiosensitivity in Non-Small Cell Lung CancerAntioxidants (Basel)May 31, 2026Cuilan Hu, Zheng Shi, Yanyu Bao, Nannan He, Xiongxiong Liu, Dan Xu, Qiang Li, Xingting Bao, Chao SunCat# CW0690M). For long PCR (16 kb), the GoTaq® Long PCR Master Mix (Promega, Madison, WI, USA; Cat# M4021), which contains a blend of hot-start recombinant Taq DNA polymerase and a proofreading DNA polymerase,

(4) Morpho-molecular characterization of Trichodina chlorophora Richards, 1948 (Protista: Ciliophora), a central component in the ‘snail‒ciliate‒zoochlorellae’ hyper-symbiotic systemMarine Life Science & TechnologyApril 7, 2026Tengyue Zhang, Peter VďačnýFitchburg, WI, USA). PCR amplification was carried out with the GoTaq® Long PCR Master Mix (Cat. no. M4021, Promega, Fitchburg, WI, USA). For trichodinids, two mitochondrial markers (16S rRNA gene and cytochrome

(5) Directionality bias in T/A cloningMicroPubl BiolApril 6, 2026Valeria Dountcheva, Athanasios Bubulya, Labib Rouhana,Thermo Fisher Scientific,K0503 GoTaq 2-Step RT-qPCR System,Promega,A6010 GoTaq® Long PCR Master Mix,Promega,M4021 pGEM®-T Vector Systems,Promega,A3600 TRIzol™ Reagent,Thermo Fisher Scientific,15596026 "Schmidtea

(6) Genetic variations and clinical implications of B-thalassemia in Iraqi populationPLoS OneMarch 4, 2026Ayman Ziadoon Jawad, Meryam Chelly, Salah Hashim Al-Zuhairy, Hanen Bouazizweb tool [5,6]. The 50 μL PCR reaction mixture contained 25 μL of GoTaq Long PCR master mix (Cat. No. M4021, Promega Corp., USA) and 2 μL of 10 μM PCR primer mix (I or II). The PCR conditions included an initial

(7) Directionality bias in T/A cloningbioRxivFebruary 16, 2026Valeria Dountcheva, Athanasios Bubulya, Labib Rouhana,Thermo Fisher Scientific,K0503 GoTaq 2-Step RT-qPCR System,Promega,A6010 GoTaq® Long PCR Master Mix,Promega,M4021 pGEM®-T Vector Systems,Promega,A3600 TRIzol™ Reagent,Thermo Fisher Scientific,15596026 "Schmidtea

(8) Distribution of CYP2D6 multiplication, CYP2D6*5, and clinical implications in postoperative patients receiving tramadol analgesia in the Minangkabau ethnic group, IndonesiaF1000ResearchSeptember 23, 2025Rinal Effendi, Aufa Rizqia Haz, Asrul Muhammad Fuad, Bagus Dermawan, Nuruliawaty Utami, . Desrianigenotyping The long PCR method of Johansson et al. (1996) was modified using Promega GoTaq Long PCR Master Mix #M4021, with the following DNA primers: Lx2F: 5′ GCC ACC ATG GTG TCT TTG CTT TC 3′, Lx2R: 5′ ACC GGA TTC CAG

(9) A novel TRKB-activating internal tandem duplication characterizes a new mechanism of receptor tyrosine kinase activationNPJ Precis OncolMay 10, 2025Lauren M. Brown, Gabor Tax, Pablo Acera Mateos, Antoine de Weck, Steve Foresto, Thomas Robertson, Fatimah Jalud, Pamela Ajuyah, Paulette Barahona, Jie Mao, et al.similar size. The ITD was PCR amplified using GoTaq® Long PCR Master Mix (Promega, catalogue number: M4021) and gel extracted for sequencing, which confirmed the sequence of the ITD. However, given the lack

(10) Protocol for CRISPR-Cas9-mediated induction of KMT2A rearrangements in cell line and umbilical cord blood hematopoietic stem and progenitor cellsSTAR ProtocolsMarch 1, 2025Tamara Benz, Patrizia Larghero, Claus Meyer, Marcel Müller, Dörthe Brüggmann, Anna-Elisabeth Hentrich, Frank Louwen, Estelle Erkner, Rahel Fitzel, Corina Schneidawind, et al.commercial assays ,, AllPrep DNA/RNA micro kit,QIAGEN,Cat# 80284 GoTaq long PCR master mix,Promega,Cat# M4021 P3 Primary Cell 4D-Nucleofector X kit V4XP-3032,Lonza,Cat# V4XP-3032 RNA Clean & Concentrator kit,Zymo,Cat#

(11) An adenoviral vector encoding an inflammation-inducible antagonist, HMGB1 Box A, as a novel therapeutic approach to inflammatory diseasesmBioFebruary 5, 2025Kari Ann Shirey, John Joseph, Lynda Coughlan, Haye Nijhuis, Alan W. Varley, Jorge C. G. Blanco, Stefanie N. Vogel5′-TAGCTGATATCCTCGAGATCGATGATACCCAATTCAACAGGC-3′. Reactions were carried out using GoTaq long PCR (Promega, M4021). Amplified fragments (cassette) were agarose gel purified and extracted (New England Biolabs, Monarch

(12) Ectopic expression of Myomaker and Myomixer in slow muscle cells induces slow muscle fusion and myofiber deathJournal of Genetics and GenomicsNovember 1, 2024Pengzheng Yong, Zhanxiong Zhang, Shaojun DuUniversity of Sheffield; Elworthy et al., 2008) as a template with GoTaq® Long PCR Master Mix (Promega M4021). The amplicon was treated with DpnI to digest residual template plasmid, separated on 0.8% and extracted

(13) Protocol for the application of single-cell damage in murine intestinal organoid modelsSTAR ProtocolsSeptember 20, 2024Anna Elisabeth Seidler, Sören Donath, Lara Gentemann, Manuela Buettner, Alexander Heisterkamp, Stefan KaliesTechnology,N/A Glass bottom dishes 35 mm,ibidi,Cat# 81218-200 GoTaq Long PCR master mix,Promega,Cat# M4021 HC FLUOTAR L 25×/0.95 W VISIR,Leica Microsystems,Cat# 11506375 Inject disposable syringes 5 mL (eccentric),B.

(14) Functional and Multi-Omics Effects of an Optimized CRISPR-Mediated FURIN Depletion in U937 MonocytesCellsMarch 28, 2024Ruiming Chua, Lijin Wang, Roshni Singaraja, Sujoy Ghoshinvolving external primers (expected amplicon size ~7.3kb) the GoTag Long PCR kit from Promega (cat: M4021) was used, and PCR was performed according to the manufacturer’s instructions. 2.5. Western Blot Proteins

(15) The Identification of Host Proteins That Interact with Non-Structural Proteins-1α and -1β of Porcine Reproductive and Respiratory Syndrome Virus-1VirusesDecember 16, 2023Sofia Riccio, Kay Childs, Ben Jackson, Simon P. Graham, Julian SeagoReadyMix™ Taq PCR Reaction Mix (#P4600, Merck) was used. For cloning, either GoTaq® Long PCR Master Mix (#M4021, Promega) or Q5® High-Fidelity DNA Polymerase (#M0494S, NEB) were used. 2.5. DNA Purification PCR

(16) Drug resistance and vaccine target surveillance of Plasmodium falciparum using nanopore sequencing in GhanaNature MicrobiologyNovember 23, 2023Sophia T. Girgis, Edem Adika, Felix E. Nenyewodey, Dodzi K. Senoo Jnr, Joyce M. Ngoi, Kukua Bandoh, Oliver Lorenz, Guus van de Steeg, Alexandria J. R. Harrott, Sebastian Nsoh, et al.results using the same primers. The msp1 PCR was performed using Promega long-range GoTaq polymerase (M4021), with reaction conditions described in Supplementary Notes. After PCR, a subset of samples from each

(17) How chromosomal translocations arise to cause cancer: Gene proximity, trans-splicing, and DNA end joiningiScienceJune 16, 2023Patrick Streb, Eric Kowarz, Tamara Benz, Jennifer Reis, Rolf MarschalekScientific,FBS-11A Glutamine,Capricorn Scientific,STA-B Glycine,Carl Roth,3908.3 GoTaq® Long PCR Master Mix,Promega,M4021 HindIII-HF,NEB,R3104L HiScribe T7 High Yield RNA Synthesis Kit,NEB,E2040S Kapa HiFi HotStart ReadyMix,Roche,KK2602 Metafectene

(18) Pyramidal neurons form active, transient, multilayered circuits perturbed by autism-associated mutations at the inception of neocortexCellApril 27, 2023Munz M, Bharioke A, Kosche G, Moreno-Juan V, Brignall A, Rodrigues TM, Graff-Meyer A, Ulmer T, Haeuselmann S, Pavlinic D, et al.genomic locations, including the flanking intronic regions, using the GoTaq Long PCR Master Mix (Cat. #M4021, Promega) and the following primers: chd8Ex3F (5’ – ggtcctggggtcaaattggt), chd8Ex3R (5’ – tcatctgtcctgcaccttaagg),

(19) Origin and function of activated fibroblast states during zebrafish heart regenerationNature geneticsAugust 1, 2022Hu B, Lelek S, Spanjaard B, El-Sammak H, Simões MG, Mintcheva J, Aliee H, Schäfer R, Meyer AM, Theis F, et al.D. rerio. PCR was carried out in a 25 µl reaction using GoTaq Long PCR Mastermix (Promega, cat no. M4021) according to the manufacturer’s protocol and TOPO cloned into pENTR5′ (Invitrogen) to create pAM222.

(20) Targeting lactate dehydrogenase B-dependent mitochondrial metabolism affects tumor initiating cells and inhibits tumorigenesis of non-small cell lung cancer by inducing mtDNA damageCellular and molecular life sciences : CMLSJuly 25, 2022Deng H, Gao Y, Trappetti V, Hertig D, Karatkevich D, Losmanova T, Urzi C, Ge H, Geest GA, Bruggmann R, et al.β-globin primer or 1 μM Mito DNA primer or 1 μM Hprt primer, and 10 μL GoTaq@ Long qPCR Master Mix (Cat. #M4021; Promega), 2 μL 1:4 diluted EvaGreen® Dye 20X in water (cat. #31000; Biotium), 0. 2 μL CXR reference dye

Be the First to Write a Review!

Higher Yield