Quick-LoadTaq2X Master Mix from New England Biolabs

Product Specs
ItemQuick-LoadTaq2X Master Mix
CompanyNew England Biolabs
Price $256.00 Inquire
Catalog NumberM0271L
Quantity500 reactions
Concentration2 X
ApplicationsDNA Analysis
TypeMaster Mix
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Short RNA chaperones promote aggregation-resistant TDP-43 conformers to mitigate neurodegenerationScienceMay 7, 2026Katie E. Copley, Jocelyn C. Mauna, Helen L. Danielson, Qizan Chen, Busra Ozguney, Marilyn Ngo, Longxin Xie, Ashleigh Smirnov, Matt Davis, Leland Mayne, et al.5’-ATGCTATCACCTCCCCTGTGTG-3’. For RT-PCR, PCR products were amplified by Quick-Load Taq 2X Master Mix (NEB, M0271L) using the following PCR program in S1000 Thermal Cycler (BIO-RAD): 95°C for 30 s, followed by 40 cycles

(2) Induction of collective behavior by β-1,3-glucans in microalgaeScience AdvancesJanuary 30, 2026Lou Lambert, Richard G. Dorrell, Antoine Danonlocated on either side of the insertion site. PCR was performed using Quick-Load Taq 2x Master Mix (M0271L, New England Biolab) according to the manufacturer’s recommendation with primers described in table

(3) Protocol for measuring force in skinned diaphragm muscle fibers of myopathic SEPN1 knockout mice following chronic tauroursodeoxycholic acid treatmentSTAR ProtocolsSeptember 1, 2025Leonardo Nogara, Serena Germani, Cosimo De Napoli, Bert Blaauw, Ester Zitotablets,Sigma-Aldrich,11836170001 Protein kinase K (PK),Sigma-Aldrich,P8044 Quick-Load Taq 2× master mix,New England Biolabs,M0271L Sodium azide,Sigma-Aldrich,S2002 "Tauroursodeoxycholic acid, sodium salt",EMD Millipore,580549 Toluidine

(4) Normalizing Body Weight with a Dietary Strategy Mitigates Obesity-Accelerated Pancreatic Carcinogenesis in MiceThe Journal of NutritionAugust 1, 2025Joanna Wirkus, Aya S. Ead, Irena Krga, Yige Wang, Matthew G. Pontifex, Michael Muller, David Vauzour, Karen E. Matsukuma, Guodong Zhang, Gerardo G. MackenzieAldrich (St. Louis, MO). PCR amplification was conducted using Quick-Load® Taq 2X Master Mix (Cat# M0271L) from New England Biolabs® Inc. (Ipswich, MA). Agarose (Cat# BP164–25), Biotium GelRed Nucleic Acid Gel Stain 10,000X in DMSO

(5) The STRIPAK complex is required for radial sorting and laminin receptor expression in Schwann cellsCell ReportsMarch 25, 2025Michael R. Weaver, Dominika Shkoruta, Marta Pellegatta, Caterina Berti, Marilena Palmisano, Scott Ferguson, Edward Hurley, Julianne French, Shreya Patel, Sophie Belin, et al.72°C for 5 min. PCR reaction mixtures were prepared with Quick Load Taq-Mix 2x (New England Biolabs M0271L). For MPZ-Cre, primers were A: 5′- CCACCACCTCTCCATTGCAC-3′, AS2: 5′- GCTGGCCCAAATGTTGCTGG-3′, 5MP2:

(6) RuvBL1/2 reduce toxic dipeptide repeat protein burden in multiple models of C9orf72-ALS/FTDLife Science AllianceFebruary 1, 2025Christopher P Webster, Bradley Hall, Olivia M Crossley, Dana Dauletalina, Marianne King, Ya-Hui Lin, Lydia M Castelli, Zih-Liang Yang, Ian Coldicott, Ergita Kyrgiou-Balli, et al.containing both control and transgene primers. Reactions contained 12.5 μl NEB Quick-Load Taq Master Mix (M0271L; NEB), 100 nM of forward and reverse primers for the control genotyping reaction (Vgll4-F: 5′–TTGGATGGAGAAGGATGGAG-3′;

(7) Investigation of the Presence of Papillomavirus in Bovine Testicles and Determination of γH2AX and Cytochrome C in Testicular Tissues Determined to be InfectedVet Med SciJanuary 10, 2025Ozhan Karatas, Mustafa Ozkaraca, Mustafa O. Atasoysamples were prepared as 20 µL in total for each DNA sample: Quick‐Load Taq 2X Master Mix (Catalogue no. M0271L, 12.5 µL; NEB), 10 µM forward primer (0.4 µL), 10 µM reverse primer (0.4 µL), DNA extract (100 ng) and

(8) Targeting Integrin α3 Blocks β1 Maturation, Triggers Endoplasmic Reticulum Stress, and Sensitizes Glioblastoma Cells to TRAIL-Mediated ApoptosisCellsApril 26, 2024Yuki Kuranaga, Bing Yu, Satoru Osuka, Hanwen Zhang, Narra S. Devi, Sejong Bae, Erwin G. Van MeirSupplemental Information. PCR amplification was carried out using the Quick-Load Taq 2X Master Mix (M0271L, New England BioLabs) with an initial denaturing step at 95 °C for 5 min, then 30 cycles with 30 s denaturation

(9) Development of a synthetic biosensor for chemical exchange MRI utilizing in silico optimized peptidesNMR in BiomedicineNovember 1, 2023Adam J. Fillion, Alexander R. Bricco, Harvey D. Lee, David E. Korenchan, Christian T. Farrar, Assaf A. Giladovernight at 37 °C. Colony PCR was performed using Quick-Load Taq 2X master mix (New England Biolabs, M0271L). Successful colonies were grown in 100 μg/mL ampicillin-rich lysogeny broth (LB) overnight at 37 °C.

(10) Protein expression and purification of bioactive growth factors for use in cell culture and cellular agricultureSTAR ProtocolsSeptember 1, 2023Cameron Semper, Alexei Savchenko,Cell Signaling Technology,cat. no. 9806 SspI-HF,NEB,cat. no. R3132L Quick-Load Taq 2X Master Mix,NEB,cat. no. M0271L rCutSmart Buffer,NEB,cat. no. R3132L Tobacco Etch Virus (TEV) protease,This study,N/A FGF2,This study,N/A ,, Critical

(11) Sex-specific splicing occurs genome-wide during early Drosophila embryogenesisElifeJuly 19, 2023Mukulika Ray, Ashley Mae Conard, Jennifer Urban, Pranav Mahableshwarkar, Joseph Aguilera, Annie Huang, Smriti Vaidyanathan, Erica Larschanjunctions (Figure 2—figure supplement 3) listed in Supplementary file 7b and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles). 10 µL of PCR product of each replicate

(12) Sex-specific splicing occurs genome-wide during early Drosophila embryogenesiseLifeJuly 19, 2023Mukulika Ray, Ashley Mae Conard, Jennifer Urban, Pranav Mahableshwarkar, Joseph Aguilera, Annie Huang, Smriti Vaidyanathan, Erica Larschanjunctions (Figure 2—figure supplement 3) listed in Supplementary file 7b and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles). 10 µL of PCR product of each replicate

(13) De novo variants in MRTFB have gain-of-function activity in Drosophila and are associated with a novel neurodevelopmental phenotype with dysmorphic featuresGenetics in medicine : official journal of the American College of Medical GeneticsJune 1, 2023Andrews JC, Mok JW, Kanca O, Jangam S, Tifft C, Macnamara EF, Russell BE, Wang LK, Undiagnosed Diseases Network, Nelson SF, et al.established and PCR validated through single fly PCR (Gloor et al., 1993) using OneTaq PCR master mix (NEB #M0271L). Primers for PCR were designed to flank the integration site (primer sequences: Mrtf_forward ACTCAGAGCAACGTTGATCACG,

(14) Development of a Synthetic Biosensor for Chemical Exchange MRI Utilizing In Silico Optimized PeptidesbioRxivMarch 11, 2023Adam J. Fillion, Alexander R. Bricco, Harvey D. Lee, David Korenchan, Christian T. Farrar, Assaf A. Giladovernight at 37 °C. Colony PCR was performed using Quick-Load Taq 2X master mix (New England Biolabs, M0271L). Successful colonies were grown in 100 μg/mL ampicillin-rich lysogeny broth (LB) overnight at 37 °C.

(15) An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombinationeLifeJune 20, 2022Oguz Kanca, Jonathan Zirin, Yanhui Hu, Burak Tepe, Debdeep Dutta, Wen-Wen Lin, Liwen Ma, Ming Ge, Zhongyuan Zuo, Lu-Ping Liu, et al.individual insertion lines through single fly PCR (Gloor et al., 1993) using OneTaq PCR master mix (NEB #M0271L). PCR conditions were 95°C for 30 s, 95°C 30 s, 58°C 30 s, 68°C 1 min for 34 cycles, and 68°C 5 min. Confocal

(16) An expanded toolkit for Drosophila gene tagging using synthesized homology donor constructs for CRISPR-mediated homologous recombinationElifeJune 20, 2022Oguz Kanca, Jonathan Zirin, Yanhui Hu, Burak Tepe, Debdeep Dutta, Wen-Wen Lin, Liwen Ma, Ming Ge, Zhongyuan Zuo, Lu-Ping Liu, et al.individual insertion lines through single fly PCR (Gloor et al., 1993) using OneTaq PCR master mix (NEB #M0271L). PCR conditions were 95°C for 30 s, 95°C 30 s, 58°C 30 s, 68°C 1 min for 34 cycles, and 68°C 5 min. Confocal

(17) A bacterial three-hybrid assay for forward and reverse genetic analysis of RNA–protein interactionsNature ProtocolsApril 1, 2022Oliver M. Stockert, Chandra M. Gravel, Katherine E. BerryT-101) for PCR mutagenesis: Quick-Load® Taq 2X Master Mix (New England Biolabs, NEB.com, cat. no. M0271L) for dot-blot counter assay: Primary antibody, specific to prey-protein of interestAppropriate horseradish

(18) scRNA-Seq Reveals New Enteric Nervous System Roles for GDNF, NRTN, and TBX3Cellular and molecular gastroenterology and hepatologyJanuary 1, 2021Wright CM, Schneider S, Smith-Edwards KM, Mafra F, Leembruggen AJL, Gonzalez MV, Kothakapa DR, Anderson JB, Maguire BA, Gao T, et al.ATC TTG ATA AAC CTC-3′,Mut: 480 bpWT: 320 bp,"KAPA (KAPA Biosystems; Cat. #KK7352), Taq (NEB; Cat. #M0271L)",27 Gfp (ChAT-EGFP-L10a),F: 5′-TCA TAG AGG CGC AGA GTT CC-3′R: 5′-CTG AAC TTG TGG CCG TTT AC-3′,Mut:

(19) Endosome-Mediated Epithelial Remodeling Downstream of Hedgehog-Gli Is Required for Tracheoesophageal SeparationDevelopmental cellDecember 16, 2019Nasr T, Mancini P, Rankin SA, Edwards NA, Agricola ZN, Kenny AP, Kinney JL, Daniels K, Vardanyan J, Han L, et al."New England BioLabs, Incorporated",M0536S QuickLoad 2X Master Mix,"New England BioLabs, Incorporated",M0271L I-Sce1,New England Biolabs,R0694S Doxycycline hyclate,Sigma,D9891 pCR8/GW/TOPO TA Cloning Kit with One Shot TOP10 E.coli

(20) Group A Streptococcal S Protein Utilizes Red Blood Cells as Immune Camouflage and Is a Critical Determinant for Immune EvasionCell ReportsDecember 3, 2019Igor H. Wierzbicki et al.SOC Outgrowth Medium,New England BioLabs,Cat#B9020S Quick-Load® Taq 2X Master Mix,New England BioLabs,Cat#M0271L Glycine Anhydride,"Spectrum Laboratory Products, Inc.",Cat#G3063–100GM Sucrose,Sigma Aldrich,Cat#

Be the First to Write a Review!