Oligo d(T)23VN from New England Biolabs

Product Specs
ItemOligo d(T)23VN
CompanyNew England Biolabs
Price $109.00 Inquire
Catalog NumberS1327S
TargetOligo d(T)23VN
Quantity1 a260 units
ApplicationsDNA Analysis
Primer TypeOligo dT Primers
TypeOligo
Temperature-20 C

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Regulation of YAP activity by nuclear G-actin bindingNucleic Acids ResMarch 19, 2026Hong Wang, Irma M Jayawardana, Justus M Fleisch, Dennis Frank, Bing Zhao, Christos Kamaras, Peter Gebhardt, Julian Knerr, Svenja Ulferts, Shamphavi Sivabalasarma, et al.were denatured in a 10 µL reaction with 1 µg total RNA, 2 µL Oligo d(T)23 VN (New England Biolabs, S1327S), 1 µL 10 mM dNTP (New England Biolabs, N0447S) for 5 min at 65°C, then cDNA synthesis was synthesized

(2) Enhanced detection of RNA modifications in Escherichia coli utilizing direct RNA sequencingCell Reports MethodsSeptember 15, 2025Zhihao Guo, Yanwen Shao, Lu Tan, Beifang Lu, Xin Deng, Sheng Chen, Runsheng Li300 ng RNA in 6 μL nuclease-free water was first annealed with 1 μL oligo(dT)23VN primer (10 μM, NEB#S1327S) and 1 μL dNTP (10 mM, NEB#N0447S) for 3 min at 72°C, 10 min at 4°C, 1 min at 25°C with the lid temperature

(3) CRISPR-Cas9 engineering of the RAG2 locus via complete coding sequence replacement for therapeutic applicationsNature CommunicationsOctober 27, 2023Daniel Allen, Orli Knop, Bryan Itkowitz, Nechama Kalter, Michael Rosenberg, Ortal Iancu, Katia Beider, Yu Nee Lee, Arnon Nagler, Raz Somech, et al.T cells obtained on day 28 of IVTD. cDNA preparation was executed from RNA, using Oligo d(T)23 VN- S1327S (NEB), dNTPs 10 mM (Sigma-Aldrich), and M-MuLV Reverse Transcriptase (NEB). qRT-PCR reactions were conducted

(4) Molecular mechanisms of stress-induced reactivation in mumps virus condensatesCellApril 27, 2023Xiaojie Zhang, Sindhuja Sridharan, Ievgeniia Zagoriy, Christina Eugster Oegema, Cyan Ching, Tim Pflaesterer, Herman K.H. Fung, Isabelle Becher, Ina Poser, Christoph W. Müller, et al.ProLong Gold Antifade Reagent with DAPI,Cell Signaling Technology,Cat# 8961 Oligo d(T)23 primer,New England Biolabs,Cat#S1327S EDTA-free protease inhibitor cocktail,Roche,04693132001 PhosSTOP Phosphatase inhibitor cocktail,Roche,4906845001 "Benzonase

(5) FIPRESCI: droplet microfluidics based combinatorial indexing for massive-scale 5′-end single-cell RNA sequencingGenome BiologyApril 6, 2023Yun Li, Zheng Huang, Zhaojun Zhang, Qifei Wang, Fengxian Li, Shufang Wang, Xin Ji, Shaokun Shu, Xiangdong Fang, Lan Jiangthousand cells or nuclei (7 µl) were added with 3 µl 25 µM RT primers (containing RT PolyT Primer (NEB, S1327S), or RT random Primer (Thermo Scientific, SO142), or their mix)), incubated for 5 min at 55 °C to resolve

(6) Multiplex HDR for disease and correction modeling of SCID by CRISPR genome editing in human HSPCsMolecular therapy. Nucleic acidsMarch 14, 2023Iancu O, Allen D, Knop O, Zehavi Y, Breier D, Arbiv A, Lev A, Lee YN, Beider K, Nagler A, et al.obtained on days 14 and 28 of IVTD. cDNA was prepared from 50 to 150 ng RNA, using Oligo d(T)23 VN-S1327S (NEB), dNTPs 10 mM, and M-MuLV Reverse Transcriptase (cat. no. M0253S, NEB). Quantitative real-time PCR

(7) Role of lncRNA LIPE-AS1 in adipogenesisAdipocyteDecember 1, 2022Thunen A, La Placa D, Zhang Z, Shively JE.BioLabs 5ʹ RACE protocol using a Template Switching Oligo (TSO) [86]. Briefly, an Oligo d(T) primer (NEB S1327S) was annealed to the RNA template. Template Switching RT Enzyme mix (NEB M0466S) was then used for reverse

(8) Transposase-assisted tagmentation of RNA/DNA hybrid duplexesElifeJuly 23, 2020Bo Lu, Liting Dong, Danyang Yi, Meiling Zhang, Chenxu Zhu, Xiaoyu Li, Chengqi Yioligo,doi:10.1038/nprot.2014.006,PCR primers,AAGCAGTGGTATCAACGCAGAGT Sequence-based reagent,oligo dT(23)VN primer,NEB,Cat#: S1327S, Sequence-based reagent,Random primer mix,NEB,Cat#: S1330S, Sequence-based reagent,N501 primer,Illumina,PCR

(9) Transposase-assisted tagmentation of RNA/DNA hybrid duplexeseLifeJuly 23, 2020Bo Lu, Liting Dong, Danyang Yi, Meiling Zhang, Chenxu Zhu, Xiaoyu Li, Chengqi Yioligo,doi:10.1038/nprot.2014.006,PCR primers,AAGCAGTGGTATCAACGCAGAGT Sequence-based reagent,oligo dT(23)VN primer,NEB,Cat#: S1327S, Sequence-based reagent,Random primer mix,NEB,Cat#: S1330S, Sequence-based reagent,N501 primer,Illumina,PCR

(10) Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencingPeerJNovember 24, 2015Adam D. Hargreaves, John F. Mulleyreaction comprising the required amount of mRNA, 2 µl of 1 µM Oligo d(T)23 VN primer (New England BioLabs S1327S; New England BioLabs, Ipswich, MA, USA), 1 µl of 10 mM dNTPs and the appropriate volume of Rnase-free

(11) Inducible and coupled expression of the polyomavirus middle T antigen and Cre recombinase in transgenic mice: an in vivo model for synthetic viability in mammary tumour progressionBreast Cancer ResearchFebruary 1, 2014Trisha Rao, Jill J Ranger, Harvey W Smith, Sonya H Lam, Lewis Chodosh, William J Mullerreverse transcribing the isolated RNA using M-Mulv Reverse Transcriptase (#M0253S), Oligo-dT(23VN) (#S1327S) and a murine RNase inhibitor (#M0314S) (all purchased from New England Biolabs). Real-time quantitative PCR

(12) Identification of the Cysteine Protease Legumain as a Potential Chronic Hypoxia-Specific Multiple Myeloma Target GeneCellsJanuary 1, 0001"Clees AS, Stolp V, Häupl B, Fuhrmann DC, Wempe F, Seibert M, Weber S, Banning A, Tikkanen R, Williams R, et al."instructions. An amount of 3 μg of RNA was reverse-transcribed with 2 μM oligo(dT) primers (NEB, # S1327S), 2 μM random primers (New England Biolabs, Frankfurt, Germany,, # S1330S), dNTPs (New England Biolabs,

Be the First to Write a Review!

Oligo d(T)23VN

Oligo d(T)23VN from New England Biolabs

Description

New England Biolabs

Citations (12)

Reviews

Oligo d(T)23VN from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map