MspA1I from New England Biolabs

Product Specs
ItemMspA1I
CompanyNew England Biolabs
Price $317.00 Inquire
Catalog NumberR0577L
Quantity2500 units
Concentration10 u/µL
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-20 C

Sequence

CA/CG/CT/GG

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Multiscale characterization of Caenorhabditis elegans mutants to probe functional mechanisms of human actin pathological variantsiScienceNovember 21, 2025Théo Hecquet, Nadine Arbogast, Delphine Suhner, Anaïs Goetz, Grégory Amann, Selin Yürekli, Fiona Marangoni, Sophie Quintin, Johannes N. Greve, Nataliya Di Donato, et al.,New England Biolabs,R0144L Restriction enzyme: AlwI,New England Biolabs,R0513S Restriction enzyme: MspA1I,New England Biolabs,R0577S Cas9,homemade,– F-127,Sigma-Aldrich,P2443; CAS: 9003-11-6 5 mM Tris-HCl pH 8.0,Euromedex,EU0011 Triton X-100

(2) Distinct disease mutations in DNMT3A result in a spectrum of behavioral, epigenetic, and transcriptional deficitsCell ReportsNovember 28, 2023Diana C. Beard, Xiyun Zhang, Dennis Y. Wu, Jenna R. Martin, Alyssa Erickson, Jane Valeriane Boua, Nicole Hamagami, Raylynn G. Swift, Katherine B. McCullough, Xia Ge, et al.al.61,N/A Critical commercial assays,Critical commercial assays,Critical commercial assays Mspa1I,NEB,Cat# R0577 AllPrep DNA/RNA Kit,QIAGEN,Cat# 80284 Ovation Ultralow Methyl-Seq Kit,Tecan,Cat# 0335–32 Epitect

(3) Distinct disease mutations in DNMT3A result in a spectrum of behavioral, epigenetic, and transcriptional deficitsbioRxivMarch 9, 2023Diana C. Beard, Xiyun Zhang, Dennis Y. Wu, Jenna R. Martin, Nicole Hamagami, Raylynn G. Swift, Katherine B. McCullough, Xia Ge, Austin Bell-Hensley, Hongjun Zheng, et al.Proteins" Critical Commercial Assays,Critical Commercial Assays,Critical Commercial Assays Mspa1I,NEB,Cat# R0577 AllPrep DNA/RNA Kit,QIAGEN,Cat# 80284 Ovation Ultralow Methyl-Seq Kit,Tecan,Cat# 0335-32 Epitect

(4) ABCB1 variants C3435T and T129C are not associated with colorectal cancer riskAfrican Health SciencesMarch 5, 2020Areej M Al Qahtani, Ayat B Al-Ghafari, Huda A Al Doghaither, Anas H Alzahrani, Ulfat M Omar, Sawsan A RahimulddinT129C,ABCB1 SNP T129C,ABCB1 SNP T129C ,,,, TTTCACTACTTGCCCTTTCTAGAG,CGGCCTCTGCTTCTTTGAG,258 bp,MspA1I (NEB: R0577L),"(TT) 258 (TC) 36,226,258 (CC) 32,226" Primers and restriction endonucleases used for SNPs genotyping

(5) Frequency of TNFR1 36 A/G gene polymorphism in azoospermic infertile men: A case-control studyInt J Reprod BiomedOctober 31, 2017Hamid Reza Ashrafzadeh, Tahere Nazari, Masoud Dehghan Tezerjani, Maryam Khademi Bami, Saeed Ghasemi-Esmailabad, Nasrin Ghasemicut and then were taken on 3% agarose gel by enzyme MSPA1I (New England Biolabs (Neb) Co. Catalog no. R0577S). The length of amplified products containing this polymorphism was 183 base pairs. In the present study,

(6) Dissection of mitogenic and neurodegenerative actions of cystine and glutamate in malignant gliomasOncogeneJanuary 6, 2011N E Savaskan, S Seufert, J Hauke, C Tränkle, I Y Eyüpoglu, E Hahnenstaining. GluR2 ﬂip/ﬂop and Q/R isoforms were discriminated using restriction site assays. MspA1I (R0577; New England Biolabs) cleaves the GluR2 ﬂop isoform (2 h incubation). Bbv1 (R0173; New England Biolabs)

Be the First to Write a Review!

MspA1I

MspA1I from New England Biolabs

Sequence

New England Biolabs

Citations (6)

Reviews

MspA1I from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map