Wizard SV Genomic DNA Purification System from Promega

Product Specs
ItemWizard SV Genomic DNA Purification System
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA2360
Quantity50 preps
Methodmembrane-based technique
Applicationspurification
FormatMembrane adsorption
Sample TypeTissue samples, cultured cells
TimeObtain genomic DNA in approximately 20 minutes after lysis.
YieldPurify 20–30µg of DNA
SourceCell/Tissue, Tail
Nucleic Acid TypeGenomic DNA

Specifications/Features

Starting Amount:
Purify genomic DNA from up to 20mg of tissue

Starting Material:
Cltured cells and tissue, including mouse tails

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) Knockout of filamin A in KGN granulosa tumor cells impairs proliferation, cell cycle progression, migration, and cytoskeletal organization under mechanical stressBiol ResMay 20, 2026Yuhao Jiang, Karolina Magdalena Caban, Mirko Peitzsch, Carola Herrmann, Doris Mayr, Jan Bernd Stöckl, Thomas Fröhlich, Artur Mayerhofer, Annette Müller-Taubenberger, Harald WelterWT and FLNA-knockout (KO) cells was extracted using the Wizard® SV Genomic DNA Purification System (#A2360, Promega, USA) according to the manufacturer’s instructions. Genotyping was performed by PCR to amplify

(2) Flavonoid Inhibition of Bacillus licheniformis LP-8 Lipase: In Vitro and In Silico Insights Into Anti-Obesity PotentialChemistryOpenMay 14, 2026Songul Bayrak, Mehmet Akif Omeroglu, Halil SenolGenomic DNA of the strain was isolated according to the Promega WizardR Genomic DNA Purification Kit (A2360) protocol [20]. 16S rRNA gene region was then amplified using universal primers of 27F (5′‐AGAGTTTGATCCTGGCTCAG‐3′)

(3) Nucleic Acids on the Surface and Lumen of Tumor-Derived Small Extracellular Vesicles as Potential Cancer BiomarkersCellsMarch 13, 2026Alicja Gluszko, Daria Kania, Chang-Sook Hong, Monika Pietrowska, James F. Conway, Theresa L. WhitesideTEX Genomic DNA from FaDu cells was isolated using the Wizard® SV Genomic DNA Purification System (cat. A2360, Promega, Fitchburg, WI, USA), according to the manufacturer’s protocol. Concentration and purity were

(4) Reversibility and therapeutic feasibility of DNM1L-associated neurodevelopmental disordersExperimental & Molecular MedicineMarch 5, 2026Ki Hurn So, Se Hee Kim, Shinyoung Jang, Hyeun Deok Sang, Eun-Jin Yun, Hee-Jung Choi, Jong-Hee Chae, Seung Tae Baekindividually. Genomic DNA was extracted using Wizard SV Genomic DNA Purification System (Promega, #A2360), and the PCR-amplified target region was identified by Sanger sequencing. Indels were detected by CRISP-ID29. Flow cytometry analysis

(5) Development of apical out trophoblast stem cell derived organoids to model early human pregnancyiScienceMarch 21, 2025J. Zhou, M.A. Sheridan, Y. Tian, K.J. Dahlgren, M. Messler, T. Peng, A. Zhao, T. Ezashi, L.C. Schulz, B.D. Ulery, et al.HY-K0501 TURBO-DNA-free kit,Invitrogen,Cat# AM1907 Wizard® SV Genomic DNA Purification System,Promega,Cat# A2360 ,, Experimental models: Cell lines,Experimental models: Cell lines,Experimental models: Cell lines ,, hTSC

(6) Genetic diversity and virulence variability of Sclerotinia sclerotiorum in Eastern and Northeastern IndiaPLOS ONENovember 25, 2024Tasvina R. Borah, Subrata Dutta, Ashis Roy Barman, Sujit Kumar RayDNA of S. scleortiorum isolates was extracted with Promega Wizard SV Genomic DNA Purification System (A2360) according to the manufacturer’s protocol. The purified genomic DNA was quantified by loading 2μl of

(7) Analysis of soft rot Pectobacteriaceae population diversity in US potato growing regions between 2015 and 2022Frontiers in MicrobiologySeptember 16, 2024Xing Ma, Xiuyan Zhang, Paul Stodghill, Renee Rioux, Smita Shrestha, Brooke Babler, Hannah Rivedal, Kenneth Frost, Jianjun Hao, Gary Secor, et al.et al., 2015; Ma et al., 2021b), Wizard SV Genomic DNA Purification kit (Toll-Riera et al., 2016) (#A2360, Promega, Madison, WI), or ZymoBiomics DNA Miniprep Kit (#D4300, Zymo Research, Irvine, CA). DNA concentrations

(8) β-lactamase expression induces collateral sensitivity in Escherichia coliNature CommunicationsJune 3, 2024Cristina Herencias, Laura Álvaro-Llorente, Paula Ramiro-Martínez, Ariadna Fernández-Calvet, Ada Muñoz-Cazalla, Javier DelaFuente, Fabrice E. Graf, Laura Jaraba-Soto, Juan Antonio Castillo-Polo, Rafael Cantón, et al.sequencing The pOXA-48TET plasmid was extracted using the Wizard genomic DNA purification kit (Promega, Cat. A2360). The pUN4 and pBAD18 derivatives were isolated using the Plasmid Easypure isolation kit (Macherey-Nagel,

(9) Mapping SCA1 regional vulnerabilities reveals neural and skeletal muscle contributions to diseaseJCI InsightMay 8, 2024Lisa Duvick, W. Michael Southern, Kellie A. Benzow, Zoe N. Burch, Hillary P. Handler, Jason S. Mitchell, Hannah Kuivinen, Udaya Gadiparthi, Praseuth Yang, Alyssa Soles, et al.according to the manufacturer’s protocol. Tail DNA was prepared using Wizard SV Genomice DNA kit (Promega, A2360). The ATXN1 CAG repeat was PCR amplified using 1 μM each forward (6-FAM 5′-CAGAGTGGAATAGGCCTCCA-3′)

(10) The complete Kaposi sarcoma-associated herpesvirus genome induces early-onset, metastatic angiosarcoma in transgenic miceCell host & microbeMay 8, 2024Sin SH, Eason AB, Kim Y, Schneider JW, Damania B, Dittmer DP.Scientific,Cat#2602S Critical commercial assays,, Wizard SV Genomic DNA Purification System,Promega,Cat#A2360 Mouse cytokine magnetic 20-plex panel,Thermo Fisher,Cat#LMC0006M Deposited data,, Murine RNA sequence

(11) Green alternatives to petroleum-based plastics: production of bioplastic from Pseudomonas neustonica strain NGB15 using waste carbon sourceEnvironmental Science and Pollution ResearchApril 16, 2024Nurdan Gönül Baltacı, Mustafa Özkan Baltacı, Arzu Görmez, Serkan Örtücü(Sigma-Aldrich). Molecular characterization of best PHA producer isolate The Promega WizardR Genomic DNA Purification Kit (A2360) was used for the genomic DNA isolation of the best strain. The 16S rRNA gene region was amplified using

(12) MiR-290 Family Maintains Pluripotency and Self-Renewal by Regulating MAPK Signaling Pathway in Intermediate Pluripotent Stem CellsInternational Journal of Molecular SciencesFebruary 26, 2024Yueshi Liu, Xiangnan Li, Xiaozhuang Ma, Qiankun Du, Jiemin Wang, Haiquan YuDNA Methylation Analysis Total DNA was extracted using the Wizard® SV Genomic DNA Purification System (A2360, Promega, Madison, WI, USA). To determine the DNA methylation profiles of the Oct4, Sox2, Nanog promoter

(13) The nonstructural protein 1 of respiratory syncytial virus hijacks host mitophagy as a novel mitophagy receptor to evade the type I IFN response in HEp-2 cellsmBioDecember 19, 2023Cheng J, Wang Y, Yin L, Liang W, Zhang J, Ma C, Zhang Y, Liu B, Wang J, Zhao W, et al.mtDNA content Total DNA was isolated from the cells using WizardSV Genomic DNA Purification System (A2360; Promega). The DNA concentration was measured by NanoDrop 2000c Spectrophotometer. Relative mtDNA content

(14) Vpx requires active cellular dNTP biosynthesis to effectively counteract the anti-lentivirus activity of SAMHD1 in macrophagesJournal of Biological ChemistryAugust 1, 2023Nicole E. Bowen, Sijia Tao, Young-Jae Cho, Raymond F. Schinazi, Baek Kimmacrophages at indicated time points using the Wizard SV Genomic DNA Purification System (Promega; A2360) following the manufacturer’s protocol. qPCR was performed in LightCycler 480 Multiwell Plate 96 plates

(15) Lactate promotes neuronal differentiation of SH-SY5Y cells by lactate-responsive gene sets through NDRG3-dependent and -independent mannersThe Journal of biological chemistryJune 1, 2023Xu Y, Kusuyama J, Osana S, Matsuhashi S, Li L, Takada H, Inada H, Nagatomi R.manufacturer’s protocol. Meantime, genome DNA was isolated using Wizard SV Genomic DNA Purification System (A2360, Promega), and the concentration of lactate was normalized to the corresponding genome DNA values. Immunocytochemistry SH-SY5Y

(16) Efficient bi-allelic tagging in human induced pluripotent stem cells using CRISPRSTAR ProtocolsMarch 1, 2023Xingjie Ren, Maya Asami Takagi, Yin ShenA9282 QIAGEN Plasmid Plus Midi Kit,QIAGEN,Cat# 12943 Wizard SV Genomic DNA Purification System,Promega,Cat# A2360 NEBNext High-Fidelity 2× PCR Master Mix,NEB,Cat# M0541S NEBuilder HiFi DNA Assembly Master Mix,NEB,Cat#

(17) Role of the Mitochondrial Permeability Transition in Bone Metabolism and AgingJournal of Bone and Mineral ResearchFebruary 20, 2023Rubens Sautchuk, Chen Yu, Matthew McArthur, Christine Massie, Paul S. Brookes, George A. Porter, Hani Awad, Roman A. Eliseevprimer,GCGGATCTTGAAGTTCACCTTGATGCCGT Commercial assay or kit,Wizard SV DNA purification kit,Promega,A2360, Commercial assay or kit,Rat / Mouse PINP ELISA Kit,Immune Diagnostic Systems,AC-33F1, Commercial

(18) Deep mutational scanning of essential bacterial proteins can guide antibiotic developmentNature CommunicationsJanuary 16, 2023Liselot Dewachter, Aaron N. Brooks, Katherine Noon, Charlotte Cialek, Alia Clark-ElSayed, Thomas Schalck, Nandini Krishnamurthy, Wim Versées, Wim Vranken, Jan Michiels2022. 1001182 RevB.), which uses the Wizard SV Genomic DNA Purification System (Promega, Cat. #A2365/A2360/A2361). PCR amplification of 2 kb genomic regions flanking each gene of interest (fabZ, lpxC, murA)

(19) The immune checkpoint molecule, VTCN1/B7-H4, guides differentiation and suppresses proinflammatory responses and MHC class I expression in an embryonic stem cell-derived model of human trophoblastFrontiers in endocrinologyJanuary 1, 2023Zhou J, Tian Y, Qu Y, Williams M, Yuan Y, Karvas RM, Sheridan MA, Schulz LC, Ezashi T, Roberts MR, et al.wells had spent culture medium collected on culture days 7 and 8. Total DNA was isolated (Promega, #A2360) from the respective cultures in order to normalize immunoassay results to cell density levels. ELISAs

(20) Comparative functional RNA editomes of neural differentiation from human PSCsLife MedicineOctober 1, 2022Yu Zhang, Qu Zhang, Yuhong Hou, Ran Wang, Yu WangRNA and genomic DNA using Trizol kit (Cat# 15596026, Invitrogen) and genomic DNA isolation kit (Cat# A2360, Promega), respectively. One microgram total RNA was used for reverse transcription following the instruction

Be the First to Write a Review!

Wizard® SV Genomic DNA Purification System From Promega
Pure genomic DNA has numerous applications in molecular biology, including PCR and restriction ... Read More