FseI from New England Biolabs

Product Specs
ItemFseI
CompanyNew England Biolabs
Price $80.00 Inquire
Catalog NumberR0588S
Concentration2 u/µL
Quantity100 units
ApplicationsDNA Manipulation
TypeRestriction Enzyme
Temperature-80 C

Sequence

GGCCGG/CC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Neuropeptidergic circuit modulation of developmental sleep in DrosophilaeLifeApril 8, 2026Chikayo Hemmi, Kenichi Ishii, Mana Motoyoshi, Masato Tsuji, Kazuo EmotoThe PCR product and the vector were double-digested by Aat II (NEB, cat# R0117S) and Fse I (NEB, cat# R0588S), followed by ligation using In-Fusion HD Cloning Kit w/Cloning Enhancer (Takara Bio, cat# 639635).

(2) Chromatin dynamics of the Klf4 locus in mouse pluripotent cellsScientific ReportsMarch 27, 2026Jente van Staalduinen, Hélène Kabbech, Selçuk Yavuz, Ridvan Cetin, Agnese Loda, Wiggert van Cappellen, Adriaan Houtsmuller, Kerstin Wendt, Ihor Smal, Frank Grosveld(438)]. This was achieved via a restriction-ligation cloning using FseI (New England Biolabs, Catalog no: R0588L) and KpnI-HF (New England Biolabs, Catalog no: R3142S). This new plasmid is designated as B-SpCas9-HF1-2A-PuroR. Single

(3) Discovery of NANOG enhancers and their essential roles in self-renewal and differentiation in human embryonic stem cellsStem Cell ReportsJune 10, 2025Jielin Yan, Renhe Luo, Bess P. Rosen, Dingyu Liu, Wilfred Wong, Christina S. Leslie, Danwei Huangfu(Takara Bio, 639648) into a plasmid (Addgene: 83481), digested with NheI (NEB R0131) and FseI (NEB R0588S), and transformed into competent E. coli (NEB, C2987H). Out of the five heterozygous SNPs identified

(4) Isogenic comparison of Airn and Xist reveals core principles of Polycomb recruitment by lncRNAsMolecular CellMarch 20, 2025Jackson B. Trotman, Elizabeth W. Abrash, McKenzie M. Murvin, Aki K. Braceros, Shuang Li, Samuel P. Boyson, Ryan T. Salcido, Rachel E. Cherney, Steven R. Bischoff, Kyle Kaufmann, et al.positive clone was maxiprepped, and the selectable marker was removed through digestion with FseI (NEB, R0588S) at 37°C for 4 hours. The reaction was purified using phenol:chloroform extraction and ethanol precipitation,

(5) Microvilli control the morphogenesis of the tectorial membrane extracellular matrixDevelopmental CellMarch 1, 2025Ava Niazi, Ju Ang Kim, Dong-Kyu Kim, Di Lu, Igal Sterin, Joosang Park, Sungjin Park,New England Biolabs,Cat# R0558S HindIII-HF,New England Biolabs,Cat# R3104S FseI,New England Biolabs,Cat# R0588S PshAI,New England Biolabs,Cat# R0593S T4 DNA Ligase,New England Biolabs,Cat# M0202S CloneAmp HiFi

(6) End resection and telomere healing of DNA double-strand breaks during nematode programmed DNA eliminationNucleic Acids ResearchAugust 27, 2024Brandon Estrem, Richard E Davis, Jianbin Wangplugs were treated with the restriction enzymes AsiSI, FseI, AscI and/or PmeI (NEB, catalog #R0630, #R0588, #R0558 and #R0560) to generate DSBs as internal controls. DSBs were blunted with exonuclease VII (NEB,

(7) MIB2 Functions in Oocyte Meiosis by Modulating Chromatin ConfigurationMolecular & Cellular ProteomicsAugust 1, 2024Yifei Jin, Guangyi Sun, Jiashuo Li, Qing Cheng, Hongzheng Sun, Longsen Han, Xuejiang Guo, Shuai Zhu, Qiang Wangpreviously (Zeng et al., 2018). Purified PCR products were digested with EcoRI and AscI (R3101S and R0588S, NEB), and then cloned into the pCS2+ vector with Myc tags. For mRNA synthesis, the plasmids were linearized

(8) Protocol to visualize and quantify the COPII concentration and anterograde transport of nascent G protein-coupled receptorsSTAR ProtocMarch 13, 2024Xin Xu, Guangyu Wu(DMEM),HyClone,Cat# SH30243.01HI Fetal bovine serum (FBS),HyClone,Cat# SH30396.03HI FseI,New England Biolabs,Cat# R0588S HCl,Sigma-Aldrich,Cat# 320331 HEPES (1 M),Gibco,Cat# 15630056 NaCl,Thermo Fisher Scientific,Cat#

(9) A Lac Repressor-Inducible Baculovirus Expression Vector for Controlling Adeno-Associated Virus Capsid RatiosVirusesDecember 28, 2023Jeffrey Slack, Christopher Nguyen, Amanda Ibe-Enwoafter LacOVP2 cassette insertion. The VB-LacR-LacOVP1 bacmid was linearized with the FseI REN enzyme (#R0588L, New England Biolabs) and then ligated to a synthetically made (GenScript) LacO-p10-LacO-VP2 cassette

(10) Efficient Formation of Single-copy Human Artificial ChromosomesbioRxivJuly 7, 2023Craig W. Gambogi, Elie Mer, David M. Brown, George Yankson, Janardan N. Gavade, Glennis A. Logsdon, Patrick Heun, John I. Glass, Ben E. Blackagarose plugs by resuspending 5 × 106 cells/ml in 0.8% agarose and digested overnight with Fse1 (NEB; R0588L) at 37 °C. Digested DNA was separated via CHEF electrophoresis (Bio-Rad, CHEF DR II System) at 3 V/Cm,

(11) Sparse and stereotyped encoding implicates a core glomerulus for ant alarm behaviorCellJuly 6, 2023Hart T, Frank DD, Lopes LE, Olivos-Cisneros L, Lacy KD, Trible W, Ritger A, Valdés-Rodríguez S, Kronauer DJC.assembly of pBAC-ie1-DsRed-ie1-GCaMP6s (linearized using double restriction digest with FseI [NEB #R0588S] and AfeI [NEB # R0652S]), QF2, and 15xQUAS. pBAC-ie1-DsRed-ObirOrco-QF2–15xQUAS-GCaMP6s from Gibson

(12) Domains required for the interaction of the central negative element FRQ with its transcriptional activator WCC within the core circadian clock of NeurosporaJournal of Biological ChemistryJuly 1, 2023Bin Wang, Jay C. Dunlap(5′-CAGCACATGTTCAACTTCATCAC-3′) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB, Catalog # R0588S) (FRQ aa 438–675), and “frq segment 4F” (5′-CACCGATCTTTCAGGAGACCCTG-3′) and “frq segment 4R” (5′-CACTCAGGTC

(13) A self‐propagating, barcoded transposon system for the dynamic rewiring of genomic networksMolecular Systems BiologyJune 12, 2023Max A English, Miguel A Alcantar, James J Collins,New England Biolabs,M0494L BbsI‐HF,New England Biolabs,R3539L BsmBI‐v2,New England Biolabs,R0739L FseI,New England Biolabs,R0588L SbfI‐HF,New England Biolabs,R3642L T4 DNA Ligase,New England Biolabs,M0202L Carbenicillin disodium salt

(14) Comparison of the structure-function properties of wild-type human apoA-V and a C-terminal truncation associated with elevated plasma triglyceridesmedRxivFebruary 26, 2023Sylvia Stankov, Cecilia Vitali, Joseph Park, David Nguyen, Leland Mayne, S. Walter Englander, Michael G. Regeneron Genetics Center, Michael G. Vujkovic, Nicholas J. Vujkovic, Nicholas J. Phillips, et al.5’-AATAATGGCCGGCCCGGACCCCTAGATGCTCTCCGAGGAGGTGCGCCAGCGACTTCAGGCTTTCCGCCAGGACACCTACCTGCAGATAGCTGCCTTCACTCGCGCCATCGACCAGGAGACTGAGGAGGTCCAGCAGCAGCTGGCGCCACCTCCACCAGGCCACAGTGCCTTCGCCCCAGAGTTTCAACAAACAGACAGTGGCAAGGTTCTGAGCAAGCTGCAGGCCCGTCTGGATGACCTGTGGGAAGACATCACTCACAGCCTTCATGACCAGGGCCACAGCCATCTGGGGGACCCCTGATAATGAATTCCATATAT-3’ was digested with FseI (NEB, R0588S) and EcoRI-HF then purified (QIAquick PCR Purification Kit, 28104). This fragment was sub-cloned into

(15) Macrophage NFATC2 mediates angiogenic signaling during mycobacterial infectionCell reportsDecember 13, 2022Brewer WJ, Xet-Mull AM, Yu A, Sweeney MI, Walton EM, Tobin DM.R0145L DpnI,NEB,Cat# R0176L XmaI,NEB,Cat# R0180L PfIMI,NEB,Cat# R0509L MwoI,NEB,Cat# R0573L FseI,NEB,Cat# R0588L NotI,NEB,Cat# R3189L Total RNA Cleanup Kit,NEB,Cat# T2010S RNA Cleanup Kit (50 μg),NEB,Cat# T2040L 6.5mm

(16) The nematode Oscheius tipulae as a genetic model for programmed DNA eliminationCurrent BiologyDecember 1, 2022Thomas C. Dockendorff, Brandon Estrem, Jordan Reed, James R. Simmons, Sobhan Bahrami Zadegan, Maxim V. Zagoskin, Vincent Terta, Eduardo Villalobos, Erin M. Seaberry, Jianbin Wangplugs were digested with the restriction enzyme AsiSI (NEB, catalog # R0630) or FseI (NEB, catalog # R0588) to generate DSBs as an internal control. DSBs were blunted with exonuclease VII (NEB, catalog # R0630)

(17) Osteoclast-mediated resorption primes the skeleton for successful integration during axolotl limb regenerationeLifeOctober 11, 2022Camilo Riquelme-GuzmÃ¡n, Stephanie L Tsai, Karen Carreon Paz, Congtin Nguyen, David Oriola, Maritta Schuez, Jan BruguÃ©s, Joshua D Currie, Tatiana Sandoval-GuzmÃ¡npromoter. For ligation, plasmid restriction was performed using the FseI and XhoI restriction enzymes (#R0588S, #R0146S, respectively; New England BioLabs, Frankfurt am Main, Germany). Fertilized embryos from d/d

(18) Genetic manipulation of gut microbes enables single-gene interrogation in a complex microbiomeCellFebruary 1, 2022Wen-Bing Jin, Ting-Ting Li, Da Huo, Sophia Qu, Xin V. Li, Mohammad Arifuzzaman, Svetlana F. Lima, Hui-Qing Shi, Aolin Wang, Gregory G. Putzel, et al.Concentrator,Zymo Research,Cat# D4003 Esp3I restriction enzyme,NEB,Cat# R0734S FseI restriction enzyme,NEB,Cat# R0588S Gibson Assembly Cloning Kit,NEB,Cat# E5510S GpC (M.CviPI) methyltransferases,NEB,Cat# M0227S Hemoccult

(19) Toxoplasma gondii GRA28 Is Required for Placenta-Specific Induction of the Regulatory Chemokine CCL22 in Human and MousemBioDecember 21, 2021Elizabeth N. Rudzki, Stephanie E. Ander, Rachel S. Coombs, Hisham S. Alrubaye, Leah F. Cabo, Matthew L. Blank, Nicolás Gutiérrez-Melo, J. P. Dubey, Carolyn B. Coyne, Jon P. Boylewith two restriction enzyme sites (sequence, GTTTAAACGGCCGGCC) for PseI (NEB R0560S) and FseI (NEB R0588S). This modified plasmid was then used as the template for all future Q5 reactions. Two unique gRNA sequences

(20) Precise CAG repeat contraction in a Huntington’s Disease mouse model is enabled by gene editing with SpCas9-NGCommunications BiologyDecember 1, 2021Seiya Oura, Taichi Noda, Naoko Morimura, Seiji Hitoshi, Hiroshi Nishimasu, Yoshitaka Nagai, Osamu Nureki, Masahito Ikawa#62988) with that of pX330-SpCas9-NG (Addgene plasmid #117919) using AgeI (R0552, NEB, MA, USA) and FseI (R0588, NEB) restriction enzymes. A DNA oligo (Genedesign, Osaka, Japan) was ligated into the BbsI (R0539,

Be the First to Write a Review!

FseI

FseI from New England Biolabs

Sequence

New England Biolabs

Citations (38)

Reviews

FseI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map