damMethyltransferase from New England Biolabs

Product Specs
ItemdamMethyltransferase
CompanyNew England Biolabs
Price $84.00 Inquire
Catalog NumberM0222S
Concentration8,000 units/ml
Quantity500 units
ApplicationsFunctional Genomics
TypeEnzymes
Temperature-20 C

Specifications/Features

Unit Definition:
One unit is defined as the amount of enzyme required to protect 1 µg of lambda DNA in 1 hour at 37°C in a total reaction volume of 10 µl against cleavage by MboI restriction endonuclease.

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Highly efficient chromatin conformation capture with post-enrichment in single cells by HiChewGenome BiolApril 27, 2026Zhichao Chen, Yeming Xie, Chen Zhang, Chen Tan, Fengying Ruan, Wenfang Chen, Meng Luo, Mei Guo, Zhe Xie, Huimin Cao, et al.Buffer, 0.25 μL of 32 mM S-adenosylmethionine (SAM), and 1 μL of dam Methyltransferase (NEB, Cat. No. M0222L) in a total reaction volume of 50 μL. The reaction was carried out at 37 °C for 1 h, followed by purification

(2) Interactions between the genome and the nuclear lamina are multivalent and cooperativeNature Structural & Molecular BiologyNovember 1, 2025Lise Dauban, Mathias Eder, Marcel de Haas, Vinícius H. Franceschini-Santos, J. Omar Yañez-Cuna, Moreno Martinovic, Tom van Schaik, Christ Leemans, Hans Teunissen, Koen Rademaker, et al.cells were processed in only DigWash and during Dam activation incubated with 4 U of Dam enzyme (NEB, M0222L). This Dam control sample served to account for DNA accessibility and amplification biases. The library

(3) Coordinated control of genome-nuclear lamina interactions by topoisomerase 2B and lamin B receptorNucleic acids researchSeptember 23, 2025van Schaik T, Magnitov M, de Haas M, Breda J, de Wit E, Manjon AG, Medema RH, Gothe HJ, Roukos V, Buckle AJ, et al.solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps. Dam activity was induced by incubation for 30 min at 37°C in 100 μl D-Wash

(4) The yeast genome is globally accessible in living cellsNature Structural & Molecular BiologyNovember 25, 2024Hemant K. Prajapati, Peter R. Eriksson, Paul A. Elizalde, Christopher T. Coey, Zhuwei Xu, David J. ClarkS-adenosylmethionine (SAM) and divided into five 400-µl aliquots. Dam methyltransferase (New England Biolabs (NEB) M0222L, 8 units per µl; 1.6 µg Dam per ml) was added (0, 50, 100, 200 or 400 units, final concentration in

(5) DNA-m6A calling and integrated long-read epigenetic and genetic analysis with fibertoolsGenome ResearchNovember 20, 2024Anupama Jha, Stephanie C. Bohaczuk, Yizi Mao, Jane Ranchalis, Benjamin J. Mallory, Alan T. Min, Morgan O. Hamm, Elliott Swanson, Danilo Dubocanin, Connor Finkbeiner, et al.labeled with the sequence-specific adenine methyltransferases EcoRI (GAATTC; (NEB M0211S), Dam (GATC; NEB M0222S), or TaqI (TCGA; NEB M0219S) were generated as follows: 400 ng of purified gDNA was treated for 1 h

(6) Chromatin protein complexes involved in gene repression in lamina-associated domainsThe EMBO JournalSeptember 25, 2024Stefano G Manzo, Abdelghani Mazouzi, Christ Leemans, Tom van Schaik, Nadia Neyazi, Marjon S van Ruiten, Benjamin D Rowland, Thijn R Brummelkamp, Bas van Steenselsolution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps. Dam activity was induced by incubation for 30 min at 37 °C in 100 μL D-Wash

(7) Decoding chromosome organization using CheC-PLS: chromosome conformation by proximity labeling and long-read sequencingbioRxivJune 7, 2024Kewei Xu, Yichen Zhang, James Baldwin-Brown, Thomas A. Sasani, Nitin Phadnis, Matthew P. Miller, Ofer Rogrest of the analysis was performed as above. dam methylation of naked DNA: dam enzyme (NEB, Cat# M0222S) was used according to the manufacturer’s instructions. 5 ug of genomic DNA from wildtype yeast strain

(8) Examining chromatin heterogeneity through PacBio long-read sequencing of M.EcoGII methylated genomes: an m 6 A detection efficiency and calling bias correcting pipelinebioRxivNovember 30, 2023Allison F. Dennis, Zhuwei Xu, David J. Clarkwith 1 mM SAM and incubated for 4 h at 37°C, as follows: (1) Control; (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3) +28 μl M.EcoGII at 5 U/μl (NEB M0603S). The DNA was purified using Qiagen PCR columns and quantified

(9) Fibertools: fast and accurate DNA-m6A calling using single-molecule long-read sequencingbioRxivJuly 12, 2023Anupama Jha, Stephanie C. Bohaczuk, Yizi Mao, Jane Ranchalis, Benjamin J. Mallory, Alan T. Min, Morgan O. Hamm, Elliott Swanson, Connor Finkbeiner, Tony Li, et al.(Invitrogen, cat#10977015). Taq methyltransferase (NEB, cat#M0219S), Dam methyltransferase (NEB, cat#M0222S), EcoRI methyltransferase (NEB, M0211S), ProNex® Size-Selective Chemistry (Promega, cat#NG2001), PacBio

(10) Dynamic chromosomal interactions and control of heterochromatin positioning by Ki-67EMBO reportsDecember 6, 2022van Schaik T, Manzo SG, Vouzas AE, Liu NQ, Teunissen H, de Wit E, Gilbert DM, van Steensel B.processed without antibodies or pA‐Dam protein, but instead incubated with 4 units of Dam enzyme (NEB, M0222L) during the activating step. This freely diffusing Dam moiety serves as control to account for DNA accessibility

(11) CTCF and cohesin promote focal detachment of DNA from the nuclear laminaGenome biologySeptember 1, 2022van Schaik T, Liu NQ, Manzo SG, Peric-Hupkes D, de Wit E, van Steensel B.were processed in only DigWash and during Dam activation incubated with 4 units of Dam enzyme (NEB, M0222L). This Dam control sample serves to account for DNA accessibility and amplification biases. ATAC-seq ATAC-seq

(12) Impact of chromatin context on Cas9-induced DNA double-strand break repair pathway balanceMolecular cellMay 20, 2021Schep R, Brinkman EK, Leemans C, Vergara X, van der Weide RH, Morris B, van Schaik T, Manzo SG, Peric-Hupkes D, van den Berg J, et al.permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step. This sample functions as “dam-control” over which a log2-ratio is determined.

(13) Cell cycle dynamics of lamina‐associated DNA EMBO reportsNovember 5, 2020Tom van Schaik, Mabel Vos, Daan Peric‐Hupkes, Patrick HN Celie, Bas van Steenselwith 500 ng of unmethylated plasmid in 20 μl of 1× dam MethylTransferase buffer (New England BioLabs #M0222S) supplemented with 80 μM S‐adenosylmethionine (SAM) for 30 min at 37°C. As a positive control, a concentration

(14) No evidence for DNA N ⁶ -methyladenine in mammalsScience AdvancesMarch 20, 2020Karolos Douvlataniotis, Maike Bensberg, Antonio Lentini, Björn Gylemo, Colm E. Nestorand then scanned. Human 6mdA positive control DNA Using dA methylase (DAM) (New England Biolabs, M0222), a methyl group was added to the adenine (N6) in every 5′-GATC-3′ sequence. One microgram of DNA, 1×

(15) An Adversarial DNA N⁶-Methyladenine-Sensor Network Preserves Polycomb SilencingMolecular cellJune 20, 2019Kweon SM, Chen Y, Moon E, Kvederaviciutė K, Klimasauskas S, Feldman DE.Recombinant Proteins" ,, MG132,MilliporeSigma,Cat#M8699-1MG Dam methyltransferase,New England Biolabs,Cat#M0222S Power SYBR Green PCR Master Mix,ThermoFisher,Cat# 4367659 DNA Degradase Plus,Zymo Research,Cat#E2020 Mouse

(16) N⁶-methyldeoxyadenosine directs nucleosome positioning in Tetrahymena DNAGenome biologyNovember 19, 2018Luo GZ, Hao Z, Luo L, Shen M, Sparvoli D, Zheng Y, Zhang Z, Weng X, Chen K, Cui Q, et al.GATC site (see below) where the A can be methylated to 6mA by Dam methyltransferase (NEB, Cat. No. M0222S), ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCG(A)TCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAGGAATTCCAACGAATA In

(17) The mechanism of variability in transcription start site selectioneLifeNovember 23, 2017Libing Yu, Jared T Winkelman, Chirangini Pukhrambam, Terence R Strick, Bryce E Nickels, Richard H Ebrightderivative beta’R1148Bpa;D460A this work peptide, recombinant protein Dam methyltransferase New England BioLabs Cat# M0222S peptide, recombinant protein restriction endonuclease SbfI-HF New England BioLabs Cat# R3642S peptide,

(18) Distributed probing of chromatin structure in vivo reveals pervasive chromatin accessibility for expressed and non-expressed genes during tissue differentiation in C. elegansBMC GenomicsDecember 1, 2010Ky Sha, Sam G Gu, Luiz C Pantalena-Filho, Amy Goh, Jamie Fleenor, Daniel Blanchard, Chaya Krishna, Andrew Fireμl (≈20-30 μg) N2 genomic DNA, 0.5 μl 32 mM S-adenosyl methionine, 1.0 μl E. coli DAM (8 U/μl, NEB M0222S), 20.0 μl 10× DAM buffer, 148.5 μl dH2O. Following one hour incubation at 37°C, the reaction was terminated

(19) Error-Prone Replication through UV Lesions by DNA Polymerase θ Protects against Skin CancersCellJanuary 1, 0001Yoon JH, McArthur MJ, Park J, Basu D, Wakamiya M, Prakash L, Prakash S.,New England Biolab,M0203 T4 DNA ligase,New England Biolab,M0202 Dam methyltransferase,New England Biolab,M0222 RnaseA,ThermoFisher Scientific,EN0531 Proteinase K,ThermoFisher Scientific,25530015 ,, Softwares

Be the First to Write a Review!