DMOG from Cayman Chemical

Product Specs
ItemDMOG
CompanyCayman Chemical
Price $28.00Supplier Page View Company Product Page
Catalog Number71210
Quantity10 mg
Research AreaEpigenetics, Transcription, & Translation, Transcription Factors
FormatA crystalline solid
Molecular Weight175.1
Purity≥98%
Storage-20
FormulaC6H9NO5
OriginUSA

Add to Compare List

Cayman Chemical

Cayman Chemical Company 1180 East Ellsworth Road

Ann Arbor, Michigan 48108

United States

Phone: (800) 364-9897
(734) 971-3640

Company Profile

Website: http://www.caymanchem.com/

(1) The HIF-2 transcription factor mediates resistance to ferroptosis in pancreatic cancerMol CellApril 2, 2026Maimon E. Hubbi, Catherine L. Wang, Yasir Suhail, Nadia L. Almasri, Jane Xie, Erin E. Hollander, Kshitiz, Alexander Muir, Ben Z. Stanger, Chi V. Dangpeptides, and recombinant proteins" DFX,Millipore Sigma,Cat# 138-14-7 DMOG,Cayman Chemicals,Cat# 71210 Erastin,Selleck Chemical,Cat# S7242 Ferrostatin,Med Chem Express,Cat# SML0583 Imidazole Ketone Erastin,Selleck

(2) ORMDL Proteins Turnover via Proteasome and Autophagy Is Cell-Type Dependent and Tied to Ceramide HomeostasisFASEB JMarch 31, 2026Michal Mrkacek, Magda Tumova, Alex Puskasu, Pavol Utekal, Marek Vrbacky, Ladislav Kuchar, Petr Draber, Viktor BugajevSigma‐Aldrich; N,N‐dimethylsphingosine (N,N‐DMS; Cat# 62575) or dimethyloxallyl glycine (DMOG; Cat# 71210) from Cayman Chemical, Ann Arbor, MI, USA; or CB‐5083 (Cat# 7379) from Tocris Bioscience, Bio‐Techne,

(3) ORMDL Proteins Turnover via Proteasome and Autophagy Is Cell‐Type Dependent and Tied to Ceramide HomeostasisFASEB JMarch 10, 2026Michal Mrkacek, Magda Tumova, Alex Puskasu, Pavol Utekal, Marek Vrbacky, Ladislav Kuchar, Petr Draber, Viktor BugajevSigma‐Aldrich; N,N‐dimethylsphingosine (N,N‐DMS; Cat# 62575) or dimethyloxallyl glycine (DMOG; Cat# 71210) from Cayman Chemical, Ann Arbor, MI, USA; or CB‐5083 (Cat# 7379) from Tocris Bioscience, Bio‐Techne,

(4) Lifting regenerative barriers promotes epithelial cell fate plasticity supporting lineage conversionNature CommunicationsNovember 27, 2025Maria T. Bejar, Paula Jimenez-Gomez, Ilias Moutsopoulos, Harikrishnan Ajith, Bartomeu Colom, Jamie McGinn, Seungmin Han, Greta Skrupskelyte, Fernando J. Calero-Nieto, Berthold Göttgens, et al.HIF1a translation inhibitor KC7F2 (10 μM; SML1043, Merck) or the HIF1a protein stabiliser DMOG (1 mM;71210, Cayman) in mFAD medium (as above) during a period of 8 days. Control cultures were treated with DMSO

(5) Acidosis attenuates the hypoxic stabilization of HIF-1α by activating lysosomal degradationJ Cell BiolAugust 4, 2025Bobby White, Zhenyi Wang, Matthew Dean, Johanna Michl, Natalia Nieora, Sarah Flannery, Iolanda Vendrell, Roman Fischer, Alzbeta Hulikova, Pawel Swietachunless stated otherwise. 1% O2 was imposed by replacement of O2 by N2 within a hypoxia incubator. DMOG (71210; Cayman Chemical), MG-132 (B1793; Cambridge Bioscience), VH-298 (SML1896; Sigma-Aldrich), bafilomycin A1

(6) Persistent Activation of Endothelial Cells is Linked to Thrombosis and Inflammation in Cerebral Cavernous Malformation DiseasebioRxiv : the preprint server for biologyJuly 2, 2025Gallego-Gutierrez H, Frias-Anaya E, Bui C, Zhao L, Hsu E, Indralingam HS, Körbelin J, Trejo J, Steinberg J, Zemke NR, et al.ATAC-seq), or 100-mm plates (ChIP-seq) for 48 hours. CCM environment (500 uM DMOG [Cayman Chemical, #71210] and 10 ng/mL TNF [PeproTech, #315–01A]) and AP-1 inhibitor (40 uM T-5224 [Selleckchem, #S8966]) were

(7) Phosphocreatine Rescues Intestinal Epithelial Metabolic Dysfunction Related to Creatine Kinase Loss and Is Protective in Murine ColitisCellular and Molecular Gastroenterology and HepatologyJune 23, 2025Geetha Bhagavatula, Corey S. Worledge, Ciara Schaepe, Emily M. Murphy, Rane M. Neuhart, J. Scott Lee, Ian Cartwright, Sean P. Colgan, Caroline H.T. HallAldrich C3630), butyrate 1 mM (Sigma Aldrich, B5887), dimethyloxalylglycine 1 mM (Cayman Chemical, 71210), and IOX2 30 μM (Cayman Chemical, 11573). Doses of these additional treatments (Cr,10 butyrate,46 dimethyloxalylglycine,46,47

(8) dFLASH; dual FLuorescent transcription factor activity sensor for histone integrated live-cell reporting and high-content screeningNat CommunApril 7, 2025Timothy P. Allen, Alison E. Roennfeldt, Moganalaxmi Reckdharajkumar, Adrienne E. Sullivan, Miaomiao Liu, Ronald J. Quinn, Darryl L. Russell, Daniel J. Peet, Murray L. Whitelaw, David C. Berstenspecified otherwise, are 200 ng/mL Doxycycline (Sigma, D9891, H2O), 0.5 mM or 1 mM DMOG (Cayman Scientific, 71210, DMSO), 100 nM R5020 (Perkin-Elmer, NLP004005MG, EtOH), 35 nM Estradiol (E2, Sigma E2758, EtOH), 10

(9) Development of a Microphysiological System to Model Human Cancer Metastasis From the Colon to the LiverBiotechnology and BioengineeringMarch 1, 2025Paula G. Miller, Emina Huang, Robert Fisher, Michael L. Shuler(Figure 2). The devices were fed every day and recharged after feeding. For DMOG (Cayman Chemical #71210, Ann Arbor, MI), a working solution of 1 mM in device medium was used to feed devices daily up to five

(10) miR-210 loss leads to widespread phenotypic and gene expression changes in human 293T cellsFrontiers in GeneticsDecember 16, 2024Xiaoxiao Zhang, Zhen Meng, Chengyong Yang, Chenghao Wang, Kexin Zhang, Anxin Shi, Jingjing Guo, Yong Feng, Yan Zengcells were treated with the control DMSO (Sangon) or 0.5 mM dimethyloxalylglycine (DMOG, catalog number 71210, Cayman Chemical, Ann Arbor, MI, USA) for 24 h, unless indicated otherwise. Construction of miR-210

(11) Glucose deprivation impairs hypoxia-inducible factor-1α synthesisDiscover OncologyOctober 28, 2024Mia Hubert, Sarah Stuart, Michael Ohhfollowing treatments and final concentrations: dimethyloxalylglycine (DMOG, 1 mM, Cayman Chemicals 71210), 2-deoxy-D-glucose (2-DG, 1–100 mM, BioShop DXG498.5), cycloheximide (CHX, 20 μg/mL, Millipore Sigma

(12) Targeting Hypoxia and Thrombospondin-2 in Diabetic Wound healingFASEB JOctober 15, 2024Yaqing Huang, Hao Xing, Sophie Naud, Themis R. Kyriakidesoxygen) in a normal cell incubator for 24 hours. For drug treatment, DMOG (Cayman Chemical Company, 71210) was added to complete media at a concentration of 1 mM or 2 mM for NIH3T3s and primary dermal fibroblasts,

(13) Targeting hypoxia and thrombospondin‐2 in diabetic wound healingThe FASEB JournalOctober 15, 2024Yaqing Huang, Hao Xing, Sophie Naud, Themis R. Kyriakidesoxygen) in a normal cell incubator for 24 hours. For drug treatment, DMOG (Cayman Chemical Company, 71210) was added to complete media at a concentration of 1 mM or 2 mM for NIH3T3s and primary dermal fibroblasts,

(14) Hypoxic Memory Mediates Prolonged Tumor Intrinsic Type I Interferon Suppression to Promote Breast Cancer ProgressionCancer ResOctober 1, 2024Oihana Iriondo, Desirea Mecenas, Yilin Li, Christopher R. Chin, Amal Thomas, Aidan Moriarty, Rebecca Marker, Yiru Jess Wang, Haley Hendrick, Yonatan Amzaleg, et al.legends. The inhibitors used in this study were FG-4592 (Selleckchem, S1007), DMOG (Cayman Chemical, 71210), GSK-J4 (Selleckchem, S7070), KDM5-C70 (Xcess Biosciences, M60192–2), NSC636819 (Sigma, 5131996), MS275

(15) Hypoxic Memory Mediates Prolonged Tumor-Intrinsic Type I Interferon Suppression to Promote Breast Cancer ProgressionCancer ResearchOctober 1, 2024Oihana Iriondo, Desirea Mecenas, Yilin Li, Christopher R. Chin, Amal Thomas, Aidan Moriarty, Rebecca Marker, Yiru Jess Wang, Haley Hendrick, Yonatan Amzaleg, et al.legends. The inhibitors used in this study were FG-4592 (Selleckchem, S1007), DMOG (Cayman Chemical, 71210), GSK-J4 (Selleckchem, S7070), KDM5-C70 (Xcess Biosciences, M60192–2), NSC636819 (Sigma, 5131996), MS275

(16) Pharmacologic HIF stabilization activates costimulatory receptor expression to increase antitumor efficacy of adoptive T cell therapyScience advancesAugust 30, 2024Walter Jackson Iii, Yang Y, Salman S, Dordai D, Lyu Y, Datan E, Drehmer D, Huang TY, Hwang Y, Semenza GL.one of the following hydroxylase inhibitors (dissolved in DMSO): DMOG (Cayman Chemical, catalog no. 71210), molidustat (Selleck Chemicals, catalog no. S8138), daprodustat (Selleck Chemicals, catalog no. S8171),

(17) Deubiquitinating enzyme mutagenesis screens identify a USP43-dependent HIF-1 transcriptional responseThe EMBO JournalJuly 15, 2024Tekle Pauzaite, Niek Wit, Rachel V Seear, James A Nathanprimer,ACACTCTCTTGTGGAAAGGACGAAACACCG,ACACTCTCTTGTGGAAAGGACGAAACACCG "Chemicals, enzymes and other reagents",Source,Catalogue number Dimethyloxalylglycine (DMOG),Cayman Chemical,71210 MG132,Sigma,474790 Cyclohexamide,Sigma,01810 Roxadustat (FG-4592),Cayman Chemicals,15294 Biotin-ANP-Ub-PA,UbiQ,UbiQ-077 AF1

(18) Targeting hypoxia-inducible factor-1 alpha suppresses Helicobacter pylori -induced gastric injury via attenuation of both cag -mediated microbial virulence and proinflammatory host responsesGut MicrobesDecember 18, 2023Jennifer M. Noto, M. Blanca Piazuelo, Judith Romero-Gallo, Alberto G. Delgado, Giovanni Suarez, Konstantina Akritidou, Miguel Girod Hoffman, Juan Carlos Roa, Cormac T. Taylor, Richard M. Peekmice were subjected to intraperitoneal injection of vehicle (PBS) or DMOG (8 mg, Cayman Chemicals #71210), every 48 hours for seven days prior to H. pylori challenge. Mice were orogastrically challenged with

(19) Distinct hypoxia-induced translational profiles of embryonic and adult-derived macrophagesiScienceDecember 15, 2023Nicholas S. Wilcox, Timur O. Yarovinsky, Prakruti Pandya, Vinod S. Ramgolam, Albertomaria Moro, Yinyu Wu, Stefania Nicoli, Karen K. Hirschi, Jeffrey R. BenderG Magnetic Beads1614023,Bio-Rad,Cat # 1614023 Dimethyloxaloylglycine (DMOG),Cayman Chemicals,Cat # 71210 Dimethylsulfoxide (DMSO),Millipore Sigma,Cat # D2650 Precision Plus Protein Dual Color Standards,BioRad,Cat

(20) SUMOylation indirectly suppresses activity of the HIF-1α pathway in intestinal epithelial cellsJournal of Biological ChemistryNovember 1, 2023Mykyta I. Malkov, Darragh Flood, Cormac T. TaylorMedChemExpress (HY-111789). The pan-hydroxylase inhibitor DMOG was purchased from Cayman Chemical (catalog no.: 71210). Reagent doses and treatment durations are listed in the figure legends. Plasmid transfection Human

Be the First to Write a Review!

DMOG

DMOG

Description

Cayman Chemical

Citations (46)

Reviews

DMOG from Cayman Chemical

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map