(±)-Nutlin-3 from Cayman Chemical

Product Specs
Item(±)-Nutlin-3
CompanyCayman Chemical
Price $189.00Supplier Page View Company Product Page
Catalog Number10004372
Quantity10 mg
Research AreaCancer
FormatA crystalline solid
Molecular Weight581.5
Purity≥98%
Storage-20
FormulaC30H30Cl2N4O4
OriginUSA

Add to Compare List

Cayman Chemical

Cayman Chemical Company 1180 East Ellsworth Road

Ann Arbor, Michigan 48108

United States

Phone: (800) 364-9897
(734) 971-3640

Company Profile

Website: http://www.caymanchem.com/

(1) Multi-Step Synthesis of Chimeric Nutlin–DCA Compounds Targeting Dual Pathways for Treatment of CancerMoleculesSeptember 28, 2025Davide Illuminati, Rebecca Foschi, Paolo Marchetti, Vinicio Zanirato, Anna Fantinati, Claudio Trapella, Rebecca Voltan, Virginia CristoforiEvaluation 3.2.1. Cell Lines The biological effect of the different chimeric Nutlin-DCA and commercial Nutlin (#10004372 Cayman, Ann Arbor, Michigan, USA) compounds, resuspended in DMSO and stored at -20 °C in single-use

(2) Telomere dysfunction alters intestinal stem cell dynamics to promote cancerDevelopmental CellJune 1, 2024Kyle A. LaBella, Wen-Hao Hsu, Jiexi Li, Yutao Qi, Yonghong Liu, Jingjing Liu, Chia-Chin Wu, Yang Liu, Zingzhi Song, Yiyun Lin, et al.sequence AGTGAAGCCCTCCGAGTGTC and were selected by the addition of 10 μM Nutlin-3a (Cayman Chemical 10004372–1). Wif1 and Notum deficient colonoids were generated using lentivirus transfection of a pLentiCRISPRv2

(3) Eliminating elevated p53 signaling fails to rescue skeletal muscle defects or extend survival in lamin A/C-deficient miceCell Death DiscoveryMay 22, 2024Tyler J. Kirby, Hind C. Zahr, Ern Hwei Hannah Fong, Jan Lammerding"Donkey anti-Rabbit IgG (H + L), Alexa Fluor 488",Secondary antibody,Invitrogen,A-21206 Nutlin-3,Chemical,Cayman Chemicals,10004372 Z-DEVD-FMK,Chemical,Cayman Chemicals,14414 List of antibodies and chemicals.

(4) Integrated characterization of hepatobiliary tumor organoids provides a potential landscape of pharmacogenomic interactionsCell reports. MedicineFebruary 20, 2024Zhu Y, Tang S, Yuan Q, Fu J, He J, Liu Z, Zhao X, Li Y, Zhao Y, Zhang Y, et al.recombinant human HGF,Peprotech,Cat#100-39 Dexamethasone,Sigma-Aldrich,Cat#D4902 Nicotinamide,Sigma-Aldrich,Cat#N0636 Recombinant Human BMP-4,Peprotech,Cat#96-120-05-500 (±)-Nutlin-3,Cayman chemical,Cat#10004372 Matrigel,Corning Biocoat,Cat#356231 TrypLE Express,Thermo Fisher Scientific,Cat#12605010 Collagenase D

(5) β-catenin mediates growth defects induced by centrosome loss in a subset of APC mutant colorectal cancer independently of p53PLOS ONEFebruary 7, 2024Mohamed Bourmoum, Nikolina Radulovich, Amit Sharma, Johnny M. Tkach, Ming-Sound Tsao, Laurence PelletierXAV939 (Cayman Chemical #13596–10), ICG-001 (Cayman Chemical #16257–5), Nutlin-3a (Cayman Chemical #10004372). Antibodies p53 (Santa Cruz #SC126, WB: 0.2 μg/ml, IF: 0.8 μg/ml), CEP192 (Bethyl #A302-324A, IF:

(6) BRCA2 promotes genomic integrity and therapy resistance primarily through its role in homology-directed repairMolecular CellFebruary 1, 2024Pei Xin Lim, Mahdia Zaman, Weiran Feng, Maria Jasinfacility,N/A NP-40 (IGEPAL CA-630),Sigma-Aldrich,Cat# I8896 (±)-nutlin-3,Cayman Chemical Company,Cat# 10004372 Olaparib,MSKCC organic chemistry facility,N/A Penicillin-streptomycin,MSKCC media preparation facility,N/A Protease

(7) Proteasome Inhibition Sensitizes Liposarcoma to MDM2 Inhibition with Nutlin-3 by Activating the ATF4/CHOP Stress Response PathwayCancer ResearchAugust 1, 2023Michael P. Ludwig, Matthew D. Galbraith, Neetha Paul. Eduthan, Amanda A. Hill, Michael R. Clay, Cristiam Moreno Moreno Tellez, Breelyn A. Wilky, Anthony Elias, Joaquín Maximiliano. Espinosa, Kelly D. Sullivanin DMEM/F12 supplemented with 0.05% DMSO (vehicle control) or 10 μmol/L nutlin-3R (Cayman Chemical #10004372, CAS Number 548472–68–0) for 72 hours. Each population was then allowed a recovery period of 3 to 4

(8) Oncogenic signaling is coupled to colorectal cancer cell differentiation stateJournal of Cell BiologyJune 5, 2023Thomas Sell, Christian Klotz, Matthias M. Fischer, Rosario Astaburuaga-García, Susanne Krug, Jarno Drost, Hans Clevers, Christine Sers, Markus Morkel, Nils BlüthgenCM,in-house,5%,x,,,,, Noggin,Peprotech #250-38,100 ng/ml,x,x,x,x,, EGF,Peprotech #315-09,50 ng/ml,x,x,,,,x Nutlin3,Cayman #10004372,1 µM,,,,x,x, SB 202190,Sigma-Aldrich #S7067,3 µM,x,x,x,x,x,x A 83-01,Tocris #2939,500 nM,x,x,x,x,x,x Custom

(9) Cell differentiation modifies the p53 transcriptional program through a combination of gene silencing and constitutive transactivationCell Death & DifferentiationApril 1, 2023Roubina Tatavosian, Micah G. Donovan, Matthew D. Galbraith, Huy N. Duc, Maria M. Szwarc, Molishree U. Joshi, Amy Frieman, Ganna Bilousova, Yingqiong Cao, Keith P. Smith, et al.of the differentiation protocol cells were treated with 2.5 µM Nutlin-3R (Cayman Chemical Company, 10004372, MI, USA) or DMSO for 12 h in mTeSR1 media supplemented with 10 µM RA to activate p53. Cardiomyocytes

(10) FAM193A is a positive regulator of p53 activityCell reportsMarch 28, 2023Szwarc MM, Guarnieri AL, Joshi M, Duc HN, Laird MC, Pandey A, Khanal S, Dohm E, Bui AK, Sullivan KD, et al.G,ThermoFisher Scientific,Cat#10004D Mouse IgG-Agarose,Sigma-Aldrich,Cat#A0919 Nutlin,Cayman Chemicals,Cat#10004372 5-Fluorouracil,Sigma Aldrich,Cat#F6627 Cycloheximide,EMD Millipore,Cat#239763 Carfilzomib (PR-171),Selleck Chemicals

(11) Apoptotic brown adipocytes enhance energy expenditure via extracellular inosineNatureSeptember 8, 2022Birte Niemann et al.different stimuli (UV 200 mJ cm−2 (UVP, CL-1000 UV Crosslinker) for 10 min, 60 µM nutlin-3 (Cayman, 10004372) for 60 min, 1 µM l-(−)-NE (+)-bitartrate salt monohydrate (Sigma-Aldrich, A9512) for 60 min or 1 µM

(12) Global cellular response to chemical perturbation of PLK4 activity and abnormal centrosome numbereLifeJune 27, 2022Tkach JM, Philip R, Sharma A, Strecker J, Durocher D, Pelletier L.B,Tocris Bioscience,1384545,Used as indicated "Chemical compound, drug",Nutlin-3a,Cayman Chemical,10004372-1,600 nM "Chemical compound, drug",RO-3306,Selleck Chemicals,S7747,10 mM "Chemical compound, drug",BI-2536,ChemieTek,CT-BI2536,100

(13) Establishment of organoids using residual samples from saline flushes during endoscopic ultrasound-guided fine-needle aspiration in patients with pancreatic cancerEndoscopy international openJanuary 1, 2022Ikezawa K, Ekawa T, Hasegawa S, Kai Y, Takada R, Yamai T, Fukutake N, Ogawa H, Akazawa T, Mizote Y, et al.suppress TGF-β/BMP or p38MAPK signaling. In cases of TP53 mutants, 3 μM Nutlin 3 (Cayman Chemical; 10004372) was added to the complete medium because TP53 mutation acquires resistance to MDM2 inhibitor Nutrin-3.

(14) TranSNPs: A class of functional SNPs affecting mRNA translation potential revealed by fraction-based allelic imbalanceiScienceDecember 17, 2021Samuel Valentini, Caterina Marchioretti, Alessandra Bisio, Annalisa Rossi, Sara Zaccara, Alessandro Romanel, Alberto Ingarecombinant proteins" ,, TRIzol,Thermo Fisher Scientific,Cat# 15596026 Nutlin,Cayman chemicals,Cat#10004372 Doxorubicin,Sigma Aldrich,Cat#25316-40-9 Xba I,New England Biolabs,Cat# R0145S Nco I,New England Biolabs

(15) Three optimized assays for the evaluation of compounds that can rescue p53 mutantsSTAR ProtocolsSeptember 17, 2021Jiale Wu, Huaxin Song, Zhengyuan Wang, Min Lupowder),Beyotime,Cat# ST156 Arsenic trioxide (ATO),Sigma,Cat# 202673 Nutlin,Cayman Chemical,Cat# 10004372 Kanamycin,Sangon,Cat# A100408-0025 Zinc chloride,Sangon,Cat# A501003-0250 Isopropyl 1-thio-β-D-galactopyranoside

(16) TIRR inhibits the 53BP1-p53 complex to alter cell-fate programsMolecular cellJune 17, 2021Parnandi N, Rendo V, Cui G, Botuyan MV, Remisova M, Nguyen H, Drané P, Beroukhim R, Altmeyer M, Mer G, et al.and Recombinant Proteins","Chemicals, Peptides, and Recombinant Proteins" Nutlin-3,Cayman Chemical,10004372 Dulbecco’s modified Eagle medium,Gibco,11995-065 Penicillin-Streptomycin,Gibco,15140 RNeasy mini

(17) AHNAK controls 53BP1-mediated p53 response by restraining 53BP1 oligomerization and phase separationMolecular cellJune 17, 2021Ghodke I, Remisova M, Furst A, Kilic S, Reina-San-Martin B, Poetsch AR, Altmeyer M, Soutoglou E.103 cells/well in 6-well plates, were DMSO treated or treated with 4 μM Nutlin-3 (Cayman Chemicals, 10004372) for 16 h. After 10 to 14 days, the emerging colonies were fixed with 4% formaldehyde and stained with

(18) Assessing the origin of high-grade serous ovarian cancer using CRISPR-modification of mouse organoidsNature communicationsMay 27, 2020Lõhmussaar K, Kopper O, Korving J, Begthel H, Vreuls CPH, van Es JH, Clevers H.the cells using the Tecan D300e Digital Dispenser (Tecan). Nutlin-3a (Cayman Chemical, catalog no. 10004372), niraparib (Selleckchem, catalog no. S2741), and paclitaxel (Sigma, catalog no. T7402) were dissolved

(19) Nutlin-Induced Apoptosis Is Specified by a Translation Program Regulated by PCBP2 and DHX30Cell reportsMarch 31, 2020Rizzotto D, Zaccara S, Rossi A, Galbraith MD, Andrysik Z, Pandey A, Sullivan KD, Quattrone A, Espinosa JM, Dassi E, et al.and Recombinant Proteins","Chemicals, Peptides, and Recombinant Proteins" Nutlin,Cayman Chemicals,10004372 RG-7112,Cayman Chemicals,25673 Doxycycline,Sigma,D9891 Critical Commercial Assays,Critical Commercial

(20) SMARTer single cell total RNA sequencingNucleic Acids ResearchSeptember 19, 2019Karen Verboom et al.serum-free medium for 24 h. Finally, the cells were treated with either 8 μM of nutlin-3 (Cayman Chemicals, 10004372, dissolved in ethanol) or vehicle. Cells were trypsinized (Gibco, 25300054) 24 h post treatment and

Be the First to Write a Review!

(±)-Nutlin-3

(±)-Nutlin-3

(±)-Nutlin-3 from Cayman Chemical

Description

Cayman Chemical

Citations (38)

Reviews

(±)-Nutlin-3 from Cayman Chemical

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map