PEG 6000 from Santa Cruz Biotechnology, Inc.

Product Specs
ItemPEG 6000
CompanySanta Cruz Biotechnology, Inc.
Price $45.00Supplier Page View Company Product Page
Catalog Numbersc-302016
Quantity250 g
TypeBiochemical Reagents
Molecular Weight6000.00

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Systematic design of combination therapy by targeting master regulators of coexisting diffuse midline glioma cell statesNature GeneticsApril 22, 2026Ester Calvo Fernández, Lorenzo Tomassoni, Xu Zhang, Junqiang Wang, Aleksandar Obradovic, Pasquale Laise, Aaron T. Griffin, Lukas Vlahos, Hanna E. Minns, Diana V. Morales, et al.collected at 48 h and 72 h, filtered (0.45 µm), precipitated with PEG-6000 (Santa Cruz Biotechnology, sc-302016), resuspended and pooled. For the transcription factor single guide RNA (sgRNA) library, lentivirus

(2) Structural basis of DNA packaging by a ring-type ATPase from an archetypal viral systemNucleic acids researchAugust 26, 2022Fung HKH, Grimes S, Huet A, Duda RL, Chechik M, Gault J, Robinson CV, Hendrix RW, Jardine PJ, Conway JF, et al.

(3) Discovery of cellular substrates of human RNA-decapping enzyme DCP2 using a stapled bicyclic peptide inhibitorCell chemical biologyApril 15, 2021Luo Y, Schofield JA, Na Z, Hann T, Simon MD, Slavoff SA.

(4) Application of an immunoglobulin Y-alkaline phosphatase bioconjugate as a diagnostic tool for influenza A virusBioengineeredDecember 1, 2019Ozkan B, Budama-Kilinc Y, Cakir-Koc R, Mese S, Badur S.

(5) Association of raised levels of IL-4 and anti-TPO with hyperprolactinemiaAm J Reprod ImmunolMarch 1, 2019Kalsi AK, Halder A, Jain M, Chaturvedi PK, Mathew M, Sharma JB.

(6) Prevalence and reproductive manifestations of macroprolactinemiaEndocrineFebruary 1, 2019Kalsi AK, Halder A, Jain M, Chaturvedi PK, Sharma JB.

(7) Folate-dependent methylation of septins governs ciliogenesis during neural tube closureFASEB journal : official publication of the Federation of American Societies for Experimental BiologyAugust 1, 2017Toriyama M, Toriyama M, Wallingford JB, Finnell RH.

(8) SiC-Seq: Single-cell genome sequencing at ultra high-throughput with microfluidic droplet barcodingNature BiotechnologyJuly 1, 2017Freeman Lan, Benjamin Demaree, Noorsher Ahmed, Adam R AbateTween 20 (Sigma-Aldrich, catalog no. P9416), 5% (w/v) PEG-6000 (Santa Cruz Biotechnology, catalog no. sc-302016), and 400 nM primers FL128 (CTGTCTCTTATACACATCTCCGAGCCCACGAGACGTGTCGGGGCTGGCTTA) and FL129 (CAAGCAGAAGACGGCATACGAGATCAGCTGGCGTAATAGCG,

Be the First to Write a Review!

PEG 6000

PEG 6000 from Santa Cruz Biotechnology, Inc.

Description

Santa Cruz Biotechnology, Inc.

Citations (8)

Reviews

PEG 6000 from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map