Aphidicolin from Santa Cruz Biotechnology, Inc.

Product Specs
ItemAphidicolin
CompanySanta Cruz Biotechnology, Inc.
Price $82.00Supplier Page View Company Product Page
Catalog Numbersc-201535
Quantity1 mg
TypeBiochemical Reagents
Molecular Weight338.48

Specifications/Features

Storage:
38966-21-1

Add to Compare List

Santa Cruz Biotechnology, Inc.

10410 Finnell Street

Dallas, Texas 75220

United States

Phone: 1-800-457-3801
831-457-3801

Company Profile

Website: http://www.scbt.com/

(1) Wnt10b signaling regulates replication stress–induced chromosomal instability in human cancerLife Sci AllianceAugust 22, 2025Alexander Haas, Friederike Wenz, Janina Hattemer, Janine Wesslowski, Gary Davidson, Oksana Voloshanenko, Michael Boutros, Sergio P Acebron, Holger Bastiansand further analyzed. Cell treatments Where indicated, cells were treated with 100 nM aphidicolin (sc-201535; Santa Cruz) or 2 mM hydroxyurea (H8627-1G; Merck-Millipore) to induce replication stress. Replication

(2) RHOJ controls EMT-associated resistance to chemotherapyNatureApril 1, 2023Debaugnies M, Rodríguez-Acebes S, Blondeau J, Parent MA, Zocco M, Song Y, de Maertelaer V, Moers V, Latil M, Dubois C, et al.

(3) Centromeres as universal hotspots of DNA breakage, driving RAD51-mediated recombination during quiescenceMolecular cellFebruary 16, 2023Saayman X, Graham E, Nathan WJ, Nussenzweig A, Esashi F.

(4) Increased replication origin firing links replication stress to whole chromosomal instability in human cancerCell reportsDecember 13, 2022Böhly N, Schmidt AK, Zhang X, Slusarenko BO, Hennecke M, Kschischo M, Bastians H.

(5) Telomeric 8-oxo-guanine drives rapid premature senescence in the absence of telomere shorteningNature structural & molecular biologyJuly 1, 2022Barnes RP, de Rosa M, Thosar SA, Detwiler AC, Roginskaya V, Van Houten B, Bruchez MP, Stewart-Ornstein J, Opresko PL.217699), ETP (Cell Signaling catalog no. 2200; CAS 33419-42-0), Aphidicolin (Santa Cruz catalog no. sc-201535; CAS 38966-21-1). Recombinant DNA pLentiCRISPR v2 gRNA, OGG1 targeting sequence (exon 4:GCTACGAGAGTCCTCATATG),

(6) CDK4/6 inhibitors induce replication stress to cause long-term cell cycle withdrawalThe EMBO journalMarch 15, 2022Crozier L, Foy R, Mouery BL, Whitaker RH, Corno A, Spanos C, Ly T, Gowen Cook J, Saurin AT.Insight, HY‐101467A); S‐Trityl‐L‐cysteine (STLC; Sigma Aldrich, #164739), aphidicolin (Santa Cruz, SC‐201535), doxorubicin (Selleckchem, S1208), olaparib (Selleckchem, S1060), camptothecin (Sigma, C9911), nutlin‐3a

(7) The RAD51 recombinase protects mitotic chromatin in human cellsNature communicationsSeptember 10, 2021Wassing IE, Graham E, Saayman X, Rampazzo L, Ralf C, Bassett A, Esashi F.

(8) Simultaneously measuring the methylation of parent and daughter strands of replicated DNA at the single-molecule level by Hammer-seqNature protocolsApril 1, 2021Ming X, Zhu B, Zhang Z.

(9) Inhibition of Aurora Kinase B activity disrupts development and differentiation of salivary glandsCell death discoveryJanuary 18, 2021Shaalan AK, Teshima THN, Tucker AS, Proctor GB.

(10) Screening of potential antiviral molecules against equid herpesvirus-1 using cellular impedance measurement: Dataset of 2,891 compoundsData in briefDecember 1, 2020Thieulent C, Fortier C, Munier-Lehmann H, Suzanne P, Dallemagne P, Zientara S, Hans A, Paillot R, Vidalain PO, Pronost S, et al.

(11) DEPTOR is a direct p53 target that suppresses cell growth and chemosensitivityCell death & diseaseNovember 12, 2020Cui D, Dai X, Gong L, Chen X, Wang L, Xiong X, Zhao Y.

(12) Use of a small DNA virus model to investigate mechanisms of CpG dinucleotide-induced attenuation of virus replicationThe Journal of general virologyNovember 1, 2020Loew L, Goonawardane N, Ratcliff J, Nguyen D, Simmonds P.

(13) Warsaw Breakage Syndrome associated DDX11 helicase resolves G-quadruplex structures to support sister chromatid cohesionNature communicationsAugust 27, 2020van Schie JJM, Faramarz A, Balk JA, Stewart GS, Cantelli E, Oostra AB, Rooimans MA, Parish JL, de Almeida Estéves C, Dumic K, et al.

(14) WAPL-Dependent Repair of Damaged DNA Replication Forks Underlies Oncogene-Induced Loss of Sister Chromatid CohesionDevelopmental cellMarch 23, 2020Benedict B, van Schie JJM, Oostra AB, Balk JA, Wolthuis RMF, Riele HT, de Lange J.

(15) Mild replication stress causes aneuploidy by deregulating microtubule dynamics in mitosisCell cycle (Georgetown, Tex.)October 1, 2019Böhly N, Kistner M, Bastians H.

(16) Design, synthesis, and biological activity evaluation of (-)-6-O-desmethylantofine analogues as potent anti-cancer agentsBioorganic & medicinal chemistryJuly 15, 2019Han G, Qing L, Wu M, Wang Y, Liu Y, Liu X, Wang Z, Ding J, Meng LH, Wang Q.

(17) Deregulated Expression of Mammalian lncRNA through Loss of SPT6 Induces R-Loop Formation, Replication Stress, and Cellular SenescenceMolecular cellDecember 20, 2018Nojima T, Tellier M, Foxwell J, Ribeiro de Almeida C, Tan-Wong SM, Dhir S, Dujardin G, Dhir A, Murphy S, Proudfoot NJ.REAGENT OR RESOURCE,SOURCE,IDENTIFIER Reagent,Reagent,Reagent ,, APH,Santa Cruz,Cat# sc-201535 Tetracycline (Tet),Sigma,Cat# 87128 ,, Primers,Primers,Primers ,, Random primers,Thermo Fisher,Cat#

(18) Monoubiquitinated γ-H2AX: Abundant product and specific biomarker for non-apoptotic DNA double-strand breaksToxicology and applied pharmacologySeptember 15, 2018Luczak MW, Zhitkovich A.DMSO, −20°C) was from Bio-Vision. Staurosporine (sc-3510A, 10 mM stock in DMSO, −20°C) and aphidicolin (sc-201535, 10 mM stock in DMSO, −20°C) were from Santa Cruz Biotechnology. Bleomycin sulfate (B4518, 1.32 mM stock

(19) Cell-Penetrating Peptide Mediates Intracellular Membrane Passage of Human Papillomavirus L2 Protein to Trigger Retrograde TraffickingCellSeptember 6, 2018Zhang P, Monteiro da Silva G, Deatherage C, Burd C, DiMaio D.Proteins" "γ-Secretase Inhibitor XXI, Compound E",Millipore,Cat#565790;CAS:209986–17-4 Aphidicolin,Santa Cruz,Cat#sc-201535;CAS:38966–21-1 Protein A/G PLUS-Agarose,Santa Cruz,Cat#sc-2003 Paraformaldehyde,Electron Microscopy

(20) A new hypothesis for foregut and heart tube formation based on differential growth and actomyosin contractionDevelopment (Cambridge, England)July 1, 2017Hosseini HS, Garcia KE, Taber LA.

Be the First to Write a Review!

Aphidicolin Chemicals

Aphidicolin from Santa Cruz Biotechnology, Inc.

Description

Specifications/Features

Santa Cruz Biotechnology, Inc.

Citations (28)

Reviews

Aphidicolin from Santa Cruz Biotechnology, Inc.

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map