GoTaq Probe qPCR Master Mix from Promega

Product Specs
ItemGoTaq Probe qPCR Master Mix
CompanyPromega
Price Supplier Page View Company Product Page
Catalog NumberA6102
Quantity10ml

Add to Compare List

Promega

2800 Woods Hollow Rd

Madison, WI 53711

United States

Phone: Tel: +1 (608) 274-4330
Fax: +1 (608) 277-2516

Email: custserv@promega.com
techserv@promega.com

Company Profile

Website: http://www.promega.com

(1) GenX exposure induces neurodevelopmental impairment and synaptic toxicity in hESC-derived cerebral organoidsMater Today BioJuly 15, 2026Sung-Ae Hyun, Young-Ju Lee, Moon Yi Ko, Euijun Min, Heejin Park, Younhee Kim, Dae Youn Hwang, Byoung-Seok Lee, Minhan KaReverse Transcription Mix (Promega, #A2791). qPCR was performed using GoTaq qPCR Master Mix (Promega, #A6102) on a CFX Connect Real-Time PCR Detection System (Bio-Rad) under the following conditions: 95°C for

(2) Understanding Plasmodium vivax recurrent infections using an amplicon deep sequencing assay, identity-by-descent and model-based classificationiScienceMay 15, 2026Jason Rosado, Jiru Han, Thomas Obadia, Jacob Munro, Zeinabou Traore, Kael Schoffer, Jessica Brewster, Caitlin Bourke, Joseph M. Vinetz, Aimee R. Taylor, et al.proteins","Chemicals, peptides, and recombinant proteins" ,, GoTaq® Probe qPCR Master Mix,Promega,Cat# A6102 Quant-iT PicoGreen® dsDNA kit,Thermo Fisher Scientific,Cat# P7589 ,, Critical commercial assays,Critical

(3) Immune-mediated microbial interference governs Borrelia colonization of the tick gutiScienceMay 15, 2026Adnan Hodžić, Martin Kunert, Mia Juračić, Gorana Veinović, Ratko Sukara, Snežana Tomanović, David Seki, David BerryiQ SYBR Green Supermix,Bio-Rad,Cat# 1708882 QIAamp DNA Mini Kit,Qiagen,Cat# 51304 GoTaq Probe qPCR Mastermix,Promega,Cat# A6101 Monarch Spin PCR & DNA Cleanup Kit,New England Biolabs,Cat# T1130S MEGAscript RNAi Kit,Ambion,Cat#

(4) Deep Learning-Guided Holotomography Reveals Early Structural Remodelling During Pluripotency ExitbioRxivApril 27, 2026Hoewon Park, Geon Kim, Jeongwon Shin, Seo-Hyun Kim, Eui-been Hwang, Minji Kim, Taewoong Hwang, Arim Lim, Gyungtae Yoon, Jisu Park, et al.cDNA was diluted 10-fold, and 5 μl of diluted cDNA was mixed with GoTaq® qPCR Master Mix (Promega, A6101) according to the manufacturer’s protocol. qRT-PCR was performed using CFX Opus 96 Real-Time PCR System

(5) Pre-harvest dynamics of Aspergillus section Flavi and aflatoxin risk in hazelnut orchards of AzerbaijanFront Plant SciMarch 5, 2026Alessia Casu, Marco Camardo Leggieri, Giorgio Chiusa, Eugenio Zagottis, Giuseppe Genova, Paola Battilanireaction (20 µL final volume) contained 10 µL GoTaq qPCR Master Mix (Promega, Madison, WI, USA, item A6101), 0.6 µL of each species-specific primer pair [stock concentration 10 µM; final concentration 300 nM

(6) RNA-seq analysis reveals altered gene expression profiles in HMEC-1 cells overexpressing KRAS gene associated with brain arteriovenous malformationChin Neurosurg JMarch 1, 2026Kexin Yuan, Yahui Zhao, Haibin Zhang, Ke Wang, Yunfan Zhou, Yu Chen, Xiaolin Chen, Yuanli Zhao, Qiang HaoSuperscript III first strand synthesis system (Invitrogen, Cat# 18080051). qPCR was performed using GoTaq qPCR Master Mix (Promega, Cat# A6102) on CFX96 thermal cycler (Bio-Rad), which was conducted with 3 replicates per group. The upstream primer

(7) Assessment of the Pathogenicity of Candidatus Rickettsia Colombiensis in a Syrian Hamster Model and Serological Cross-Reactivity Between Spotted Fever Rickettsia SpeciesPathogensJanuary 29, 2026Jorge Miranda, Alejandra García, Cristina Cervera-Acevedo, Sonia Santibañez, Aránzazu Portillo, José A. Oteo, Salim Mattar(gltA) gene [38]. The assay was performed using 10 µL of GoTaq Probe qPCR Master Mix (Promega Cat. No A6101, Madison, WI, USA), 1 µL of each primer at 10 µM, and 0.5 µL of Rickettsia probe at 20 µM (FAM-BHQ1)

(8) Proliferation of activated hepatic stellate cells requires RESTMolecular MedicineJanuary 28, 2026Vladimir S Shavva, L. Tarnawski, W. Dai, N. Moruzzi, A.-S. Haller, F. Borg, S. Hansson, Q. Guo, M. Cai, E. Fekete, et al.#4368814). qPCR was performed in QuantStudio 7 Pro (ThermoFisher) using GoTaq Probe qPCR kit (Promega, #A6102, Madison, Wisconsin, USA) for Taqman qPCR or SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, #1725274,

(9) Effect of Post-Harvest Management on Aspergillus flavus Growth and Aflatoxin Contamination of Stored HazelnutsToxins (Basel)January 11, 2026Alessia Casu, Giorgio Chiusa, Eugenio Zagottis, Giuseppe Genova, Paola Battilaniperformed in a total reaction volume of 20 µL (10 µL of GoTaq qPCR 2X MM [Promega, Madison, WI, USA, item A6101], 0.6 µL each of the primers for A. flavus [FLAVIQ1-5′ GTC GTC CCC TCT CCG G 3′, FLAQ2-5′ CTGGAAAAAGATTGATTTGCG

(10) Advancing leprosy risk prediction through identification of a whole blood host transcriptomic biomarker signature including non-coding genesScientific ReportsDecember 27, 2025Matheus Rogerio Almeida, Elisa Gherardi, Suzanne van Veen, Luca Maharavo, Aart Rosmolen, Emma van Eerde, Fons J. Verbeek, Marufa Khatun, Santosh Soren, Abu Sufian Chowdhury, et al.Subsequently, a quantitative PCR was performed by mixing 10 µl of GoTaq® Probe qPCR Master Mix (Promega, A6102), 3 µl of nuclease-free water, 1 µl of the primer solution for the target gene (Supplementary Table

(11) Massive reduction of RyR1 in muscle spindles of mice carrying recessive Ryr1 mutations alters proprioception and causes scoliosisThe Journal of PhysiologyNovember 1, 2025Alexis Ruiz, Sofia Benucci, Hervé Meier, Georg Schultz, Katarzyna Buczak, Christoph Handschin, Rodrigo C. G. Pena, Susan Treves, Francesco ZorzatoControl (IPC) as a reference, except that the qPCR kit from Promega (Madison, WI, USA; catalog. no. A6102) was used. Each primer set was used in combination with a probe for fluorescence quantification during

(12) Heparin Provides Antiviral Activity Against Rhinovirus-16 via an Heparan Sulfate Proteoglycan-Independent MechanismInternational Journal of Molecular SciencesOctober 25, 2025Leanne C. Helgers, Killian E. Vlaming, Tanja M. Kaptein, Julia Eder, Jan Willem Duitman, Teunis B. H. Geijtenbeekfor 60 s. PCR Probe Kits: GoTaq® reaction mixture was obtained from Promega (Madison, WI, USA; cat # A6102). Ct values were obtained for both household mRNA (GAPDH) and target mRNA (HRV-16). The expression of

(13) Massive reduction of RyR1 in muscle spindles of mice carrying recessive Ryr1 mutations alters proprioception and causes scoliosisJ PhysiolOctober 15, 2025Alexis Ruiz, Sofia Benucci, Hervé Meier, Georg Schultz, Katarzyna Buczak, Christoph Handschin, Rodrigo C. G. Pena, Susan Treves, Francesco ZorzatoControl (IPC) as a reference, except that the qPCR kit from Promega (Madison, WI, USA; catalog. no. A6102) was used. Each primer set was used in combination with a probe for fluorescence quantification during

(14) Afucosylation of anti-dengue IgG is associated with enhanced susceptibility to dengue virus infection postvaccinationScience Translational MedicineSeptember 24, 2025Usama Ashraf, Saborni Chakraborty, Courtney Scallan, Nathan C. Lo, Maria Theresa Alera, Aaron Farmer, Mary Noreen Cabalfin-Chua, Nelson L. Michael, Alan L. Rothman, Taia T. Wangperformed on diluted reverse-transcribed reactions using the GoTaq Probe qPCR Master Mix (Promega, A6102) and the StepOnePlus Real-Time PCR system. The virus strain-specific probes and primers were as follows:

(15) Identification of Hyalomma Ticks on Migratory Birds in Poland During the 2023 and 2024 Spring SeasonsLife (Basel)August 19, 2025Klaudia Bylińska, Jan Rapczyński, Paweł Górski, Oliwia Obuch-Woszczatyńska, Damian Pietrzak, Karol Korzekwa, Małgorzata Krzyżowska, Piotr BąskaµL and consisted of 1× GoTaq® Probe qPCR Master Mix (Promega Corporation, Madison, WI, USA, Cat. No. A6102), CXR (30 nM) (Promega Corporation, Madison, WI, USA) as a passive reference, primers CCHF-I-f, CCHF-I-r,

(16) Alterations in serum exosomal miR-1207-5p levels reflect severity and progression risk in type 2 diabetic kidney diseaseBMC NephrolAugust 6, 2025Xiaochun Zhou, Jing Zhao, Jianqin Wang, Kaiying He, Hongxuan Du, Qicai You, Wenjiao Gu, Haiyu Niu, Qiaoying Jin, Yuke Kong, et al.was performed on a Model 7500 real-time PCR instrument using a GoTaq® qPCR Master Mix kit (Promega, A6101). The expression level of miR-12070p5 was normalized to the level of the U6 gene. The primers were designed

(17) Tracing mitochondrial marks of neuronal aging in iPSCs-derived neurons and directly converted neuronsCommunications biologyMay 10, 2025Varghese N, Szabo L, Cader MZ, Lejri I, Grimm A, Eckert A.DC™ Protein Assay Kit II,Bio Rad,#5000112 FlexiGene® DNA KIT,Qiagen,#51206 GoTaq® Probe qPCR Master Mix,Promega,A6102 MycoAlert® PLUS Mycoplasma Detection Kit,Lonza,LT07-701 RNeasy Mini Kit,Qiagen,74106 RT2 First Strand

(18) CHD8 interacts with BCL11A to induce oncogenic transcription in triple negative breast cancerThe EMBO JournalMay 6, 2025Mark Waterhouse, Kyren Lazarus, Maria Francesca Santolla, Sara Pensa, Eleanor Williams, Abigail J Q Siu, Hisham Mohammed, Irina Mohorianu, Marcello Maggiolini, Jason Carroll, et al.Transcriptor Reverse Transcriptase,Roche,3531252103 Reverse transcription system,Promega,A3500 GoTaq Real Time qPCR Master Mix,Promega,A6101 PowerUp SYBR Green Master Mix,Thermo Fisher Scientific,A25742 Qubit RNA HS Assay Kit,Thermo Fisher Scientific

(19) Inhibition of PRC2 enables self-renewal of blastoid-competent naive pluripotent stem cells from chimpanzeeCell Stem CellApril 3, 2025Tao Huang (黄瑫), Arthur Radley, Ayaka Yanagida, Zhili Ren (任志丽), Francesca Carlisle, Somayyeh Tahajjodi, Dongwan Kim, Paul O’Neill, James Clarke, Madeline A. Lancaster, et al.ReliaPrep™ RNA Cell Miniprep System (Promega, Z6010). cDNA was synthesized using GoTaq® Probe qPCR and RT-qPCR Systems (Promega, A6101). Data are from biological duplicates or triplicates. PCR primers are listed in the key resources table. Flow cytometry

(20) Portable molecular diagnostic platform for rapid point-of-care detection of mpox and other diseasesNat CommunMarch 24, 2025Matthew L. Cavuto, Kenny Malpartida-Cardenas, Ivana Pennisi, Marcus J. Pond, Sohail Mirza, Nicolas Moser, Mark Comer, Isobel Stokes, Lucy Eke, Sian Lant, et al.6, were used to detect the presence of VZV, HSV-1, and HSV-2. The Promega GoTaq Probe qPCR (Cat. No. A6102, Promega) was used at a final volume of 20 µL per reaction following this protocol: 2x GoTaq qPCR master mix

Be the First to Write a Review!