JC-1 from Cayman Chemical

Product Specs
ItemJC-1
CompanyCayman Chemical
Price $589.00Supplier Page View Company Product Page
Catalog Number15003
Quantity10 mg
Research AreaApoptosis, Cell Biology, Cell Death, Mitochondrial Biology
FormatA crystalline solid
Molecular Weight652.2
Purity≥90%
Storage-20
FormulaC25H27Cl4N4 • I
OriginUSA

Add to Compare List

Cayman Chemical

Cayman Chemical Company 1180 East Ellsworth Road

Ann Arbor, Michigan 48108

United States

Phone: (800) 364-9897
(734) 971-3640

Company Profile

Website: http://www.caymanchem.com/

(1) Influences of aqua-(2-formylbenzoato) triphenyltin(IV) on regression of hypoxic solid tumor through mitochondrial mediated pathway by inhibiting Hif-1 alphaScientific reportsFebruary 12, 2025Singh V, Singh R, Goswami P, Manna PP, Basu Baul TS, Mandal A, Singh AK, Koch B.induction of apoptosis, mitochondria lose their membrane potential (ΔΨ). When JC-1 (Cayman Cat No. 15003) dye binds to healthy mitochondria, it forms J-aggregates and exhibits red fluorescence (emission maxima

(2) Testosterone deficiency worsens mitochondrial dysfunction in APP/PS1 miceFrontiers in Aging NeuroscienceMay 1, 2024Tianyun Zhang, Yun Chu, Yue Wang, Yu Wang, Jinyang Wang, Xiaoming Ji, Guoliang Zhang, Geming Shi, Rui Cui, Yunxiao Kangfluorescence staining Cells were cultured on glass slides. After treatment, JC-1 working solution (Item No. 15003, Cayman, USA, 10 μg/ml), MitoTracker Red CMXRos (M7512, Invitrogen, USA), and Hoechst 33258 (Beyotime

(3) Dual Role of Vitamin C-Encapsulated Liposomal Berberine in Effective Colon Anticancer ImmunotherapyPharmaceuticals (Basel)December 20, 2023Martyna Mianowska, Magdalena Zaremba-Czogalla, Adrianna Zygmunt, Mohamed Mahmud, Regine Süss, Jerzy Gubernator(cat.no. 556044) was purchased from Becton Dickinson Polska Sp. z o.o. (Warsaw, Poland). JC-1 (cat.no. 15003) was purchased from Cayman Chemical (Michigan, MI, USA). CellTiter-Glo Luminescent Cell Viability Assay,

(4) Long noncoding RNA GATA2-AS1 augments endothelial hypoxia inducible factor 1-α induction and regulates hypoxic signalingJournal of Biological ChemistryMay 1, 2023H.S. Jeffrey Man, Noeline Subramaniam, Tiana Downs, Aravin N. Sukumar, Aninda D. Saha, Ranju Nair, Lucy Chen, Daniel Teitelbaum, Paul J. Turgeon, Kyung Ha Ku, et al.was used to stain HUVECs according to manufacturer’s recommendations. JC-1, 5 μg/ml (Cayman Chemical, 15003) was used to stain HUVECs as in (85). Briefly, HUVECs were treated with siRNA for 24 h A total of 20,000

(5) RIP3 Translocation into Mitochondria Promotes Mitofilin Degradation to Increase Inflammation and Kidney Injury after Renal Ischemia-ReperfusionCellsJune 11, 2022Feng Y, Imam Aliagan A, Tombo N, Draeger D, Bopassa JC.mitochondrial membrane potential (MMP) was qualitatively assessed in isolated mitochondria using JC-1 dye (Cayman, Cat# 15003) [33]. Mitochondria were isolated from mice kidneys in sham mice and after 60 min ischemia followed

(6) Gold(III)-P-chirogenic complex induces mitochondrial dysfunction in triple-negative breast canceriScienceMay 20, 2022Olelewe C, Kim JH, Ofori S, Mertens RT, Gukathasan S, Awuah SG.trypsinized and resuspended in 2mL PBS. A working solution of the JC-1 dye (Cayman Chemicals, Cat. #15003) was prepared by adding 100 μL of dye into 900 μL of DMEM. The cells were then exposed to 100 μL/mL

(7) 5-Lipoxygenase Inhibition Protects Retinal Pigment Epithelium from Sodium Iodate-Induced Ferroptosis and Prevents Retinal DegenerationOxidative medicine and cellular longevityJanuary 1, 2022Lee JJ, Chang-Chien GP, Lin S, Hsiao YT, Ke MC, Chen A, Lin TK.(90010), BLX-3887 (27391), deferoxamine (DFO, 14595), Erastin (17754), ferrostatin-1 (17729), JC-1 (15003), Mk-886 (10133), ML355 (18537), necrostatin-1 (11658), RSL3 (19288), Zileuton (10006967), and Z-VAD-FMK

(8) Cardiac ischemia/reperfusion stress reduces inner mitochondrial membrane protein (mitofilin) levels during early reperfusionFree radical biology & medicineOctober 1, 2020Tombo N, Imam Aliagan AD, Feng Y, Singh H, Bopassa JC.Mitochondrial membrane potential was qualitatively assessed in transfected rat myoblasts using JC-1 dye (Cayman, 15003) [34]. After, 48h transfection, media were carefully removed from twenty four-well plates and cells

(9) Uncoupling protein 2 is upregulated in melanoma cells and contributes to the activation of Akt/mTOR and ERK signalingInternational journal of oncologyMay 1, 2020Li J, Jia Y, An L, Niu C, Cong X, Zhao Y.5'‑CGTG GTCAAGACGAGATACATGAA CTCTG‑3'. JC‑1 dye was purchased from Cayman Chemicals (cat. no. 15003). Antibodies and reagents. All primary antibodies were diluted at a ratio of 1:1,000. Antibodies to

(10) Disruption of the Putative Ribosome-Binding Motif of a Scaffold Protein Impairs Cytochrome c Oxidase Subunit Expression in Leishmania majormSphereApril 24, 2019Daviel Cardenas, Charity Sylvester, Bo Cao, Catherine S. Nation, Juan C. Pizarro, Hua Lu, Jessie Guidry, Edward J. Wojcik, Ben L. Kelly

Be the First to Write a Review!

Description

Cayman Chemical

Citations (10)

Reviews

JC-1 from Cayman Chemical

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map